Torsten Engelbrecht and Konstantin Demeter
Lockdowns and hygienic measures around the world are based on numbers of cases and mortality rates created by the so-called SARS-CoV-2 RT-PCR tests used to identify “positive” patients, whereby “positive” is usually equated with “infected.”
But looking closely at the facts, the conclusion is that these PCR tests are meaningless as a diagnostic tool to determine an alleged infection by a supposedly new virus called SARS-CoV-2.
Unfounded “Test, test, test,…” mantra
At the media briefing on COVID-19 on March 16, 2020, the WHO Director General Dr Tedros Adhanom Ghebreyesus said:
We have a simple message for all countries: test, test, test.”
The message was spread through headlines around the world, for instance by Reuters and the BBC.
Still on the 3 of May, the moderator of the heute journal — one of the most important news magazines on German television— was passing the mantra of the corona dogma on to his audience with the admonishing words:
Test, test, test—that is the credo at the moment, and it is the only way to really understand how much the coronavirus is spreading.”
This indicates that the belief in the validity of the PCR tests is so strong that it equals a religion that tolerates virtually no contradiction.
But it is well known that religions are about faith and not about scientific facts. And as Walter Lippmann, the two-time Pulitzer Prize winner and perhaps the most influential journalist of the 20th century said: “Where all think alike, no one thinks very much.”
So to start, it is very remarkable that Kary Mullis himself, the inventor of the Polymerase Chain Reaction (PCR) technology, did not think alike. His invention got him the Nobel prize in chemistry in 1993.
Unfortunately, Mullis passed away last year at the age of 74, but there is no doubt that the biochemist regarded the PCR as inappropriate to detect a viral infection.
The reason is that the intended use of the PCR was, and still is, to apply it as a manufacturing technique, being able to replicate DNA sequences millions and billions of times, and not as a diagnostic tool to detect viruses.
How declaring virus pandemics based on PCR tests can end in disaster was described by Gina Kolata in her 2007 New York Times article Faith in Quick Test Leads to Epidemic That Wasn’t.
Lack of a valid gold standard
Moreover, it is worth mentioning that the PCR tests used to identify so-called COVID-19 patients presumably infected by what is called SARS-CoV-2 do not have a valid gold standard to compare them with.
This is a fundamental point. Tests need to be evaluated to determine their preciseness — strictly speaking their “sensitivity”[1] and “specificity” — by comparison with a “gold standard,” meaning the most accurate method available.
As an example, for a pregnancy test the gold standard would be the pregnancy itself. But as Australian infectious diseases specialist Sanjaya Senanayake, for example, stated in an ABC TV interview in an answer to the question “How accurate is the [COVID-19] testing?”:
If we had a new test for picking up [the bacterium] golden staph in blood, we’ve already got blood cultures, that’s our gold standard we’ve been using for decades, and we could match this new test against that. But for COVID-19 we don’t have a gold standard test.”
Jessica C. Watson from Bristol University confirms this. In her paper “Interpreting a COVID-19 test result”, published recently in The British Medical Journal, she writes that there is a “lack of such a clear-cut ‘gold-standard’ for COVID-19 testing.”
But instead of classifying the tests as unsuitable for SARS-CoV-2 detection and COVID-19 diagnosis, or instead of pointing out that only a virus, proven through isolation and purification, can be a solid gold standard, Watson claims in all seriousness that, “pragmatically” COVID-19 diagnosis itself, remarkably including PCR testing itself, “may be the best available ‘gold standard’.” But this is not scientifically sound.
Apart from the fact that it is downright absurd to take the PCR test itself as part of the gold standard to evaluate the PCR test, there are no distinctive specific symptoms for COVID-19, as even people such as Thomas Löscher, former head of the Department of Infection and Tropical Medicine at the University of Munich and member of the Federal Association of German Internists, conceded to us[2].
And if there are no distinctive specific symptoms for COVID-19, COVID-19 diagnosis — contrary to Watson’s statement — cannot be suitable for serving as a valid gold standard.
In addition, “experts” such as Watson overlook the fact that only virus isolation, i.e. an unequivocal virus proof, can be the gold standard.
That is why I asked Watson how COVID-19 diagnosis “may be the best available gold standard,” if there are no distinctive specific symptoms for COVID-19, and also whether the virus itself, that is virus isolation, wouldn’t be the best available/possible gold standard. But she hasn’t answered these questions yet – despite multiple requests. And she has not yet responded to our rapid response post on her article in which we address exactly the same points, either, though she wrote us on June 2nd: “I will try to post a reply later this week when I have a chance.”
No proof for the RNA being of viral origin
Now the question is: What is required first for virus isolation/proof? We need to know where the RNA for which the PCR tests are calibrated comes from.
As textbooks (e.g., White/Fenner. Medical Virology, 1986, p. 9) as well as leading virus researchers such as Luc Montagnier or Dominic Dwyer state, particle purification — i.e. the separation of an object from everything else that is not that object, as for instance Nobel laureate Marie Curie purified 100 mg of radium chloride in 1898 by extracting it from tons of pitchblende — is an essential pre-requisite for proving the existence of a virus, and thus to prove that the RNA from the particle in question comes from a new virus.
The reason for this is that PCR is extremely sensitive, which means it can detect even the smallest pieces of DNA or RNA — but it cannot determine where these particles came from. That has to be determined beforehand.
And because the PCR tests are calibrated for gene sequences (in this case RNA sequences because SARS-CoV-2 is believed to be a RNA virus), we have to know that these gene snippets are part of the looked-for virus. And to know that, correct isolation and purification of the presumed virus has to be executed.
Hence, we have asked the science teams of the relevant papers which are referred to in the context of SARS-CoV-2 for proof whether the electron-microscopic shots depicted in their in vitro experiments show purified viruses.
But not a single team could answer that question with “yes” — and NB., nobody said purification was not a necessary step. We only got answers like “No, we did not obtain an electron micrograph showing the degree of purification” (see below).
We asked several study authors “Do your electron micrographs show the purified virus?”, they gave the following responses:
Study 1: Leo L. M. Poon; Malik Peiris. “Emergence of a novel human coronavirus threatening human health” Nature Medicine, March 2020
Replying Author: Malik Peiris
Date: May 12, 2020
Answer: “The image is the virus budding from an infected cell. It is not purified virus.”
Study 2: Myung-Guk Han et al. “Identification of Coronavirus Isolated from a Patient in Korea with COVID-19”, Osong Public Health and Research Perspectives, February 2020
Replying Author: Myung-Guk Han
Date: May 6, 2020
Answer: “We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells.”
Study 3: Wan Beom Park et al. “Virus Isolation from the First Patient with SARS-CoV-2 in Korea”, Journal of Korean Medical Science, February 24, 2020
Replying Author: Wan Beom Park
Date: March 19, 2020
Answer: “We did not obtain an electron micrograph showing the degree of purification.”
Study 4: Na Zhu et al., “A Novel Coronavirus from Patients with Pneumonia in China”, 2019, New England Journal of Medicine, February 20, 2020
Replying Author: Wenjie Tan
Date: March 18, 2020
Answer: “[We show] an image of sedimented virus particles, not purified ones.”
Regarding the mentioned papers it is clear that what is shown in the electron micrographs (EMs) is the end result of the experiment, meaning there is no other result that they could have made EMs from.
That is to say, if the authors of these studies concede that their published EMs do not show purified particles, then they definitely do not possess purified particles claimed to be viral. (In this context, it has to be remarked that some researchers use the term “isolation” in their papers, but the procedures described therein do not represent a proper isolation (purification) process. Consequently, in this context the term “isolation” is misused).
Thus, the authors of four of the principal, early 2020 papers claiming discovery of a new coronavirus concede they had no proof that the origin of the virus genome was viral-like particles or cellular debris, pure or impure, or particles of any kind. In other words, the existence of SARS-CoV-2 RNA is based on faith, not fact.
We have also contacted Dr Charles Calisher, who is a seasoned virologist. In 2001, Science published an “impassioned plea…to the younger generation” from several veteran virologists, among them Calisher, saying that:
[modern virus detection methods like] sleek polymerase chain reaction […] tell little or nothing about how a virus multiplies, which animals carry it, [or] how it makes people sick. [It is] like trying to say whether somebody has bad breath by looking at his fingerprint.”[3]
And that’s why we asked Dr Calisher whether he knows one single paper in which SARS-CoV-2 has been isolated and finally really purified. His answer:
I know of no such a publication. I have kept an eye out for one.”[4]
This actually means that one cannot conclude that the RNA gene sequences, which the scientists took from the tissue samples prepared in the mentioned in vitro trials and for which the PCR tests are finally being “calibrated,” belong to a specific virus — in this case SARS-CoV-2.
In addition, there is no scientific proof that those RNA sequences are the causative agent of what is called COVID-19.
In order to establish a causal connection, one way or the other, i.e. beyond virus isolation and purification, it would have been absolutely necessary to carry out an experiment that satisfies the four Koch’s postulates. But there is no such experiment, as Amory Devereux and Rosemary Frei recently revealed for OffGuardian.
The necessity to fulfill these postulates regarding SARS-CoV-2 is demonstrated not least by the fact that attempts have been made to fulfill them. But even researchers claiming they have done it, in reality, did not succeed.
One example is a study published in Nature on May 7. This trial, besides other procedures which render the study invalid, did not meet any of the postulates.
For instance, the alleged “infected” laboratory mice did not show any relevant clinical symptoms clearly attributable to pneumonia, which according to the third postulate should actually occur if a dangerous and potentially deadly virus was really at work there. And the slight bristles and weight loss, which were observed temporarily in the animals are negligible, not only because they could have been caused by the procedure itself, but also because the weight went back to normal again.
Also, no animal died except those they killed to perform the autopsies. And let’s not forget: These experiments should have been done before developing a test, which is not the case.
Revealingly, none of the leading German representatives of the official theory about SARS-Cov-2/COVID-19 — the Robert Koch-Institute (RKI), Alexander S. Kekulé (University of Halle), Hartmut Hengel and Ralf Bartenschlager (German Society for Virology), the aforementioned Thomas Löscher, Ulrich Dirnagl (Charité Berlin) or Georg Bornkamm (virologist and professor emeritus at the Helmholtz-Zentrum Munich) — could answer the following question I have sent them:
If the particles that are claimed to be to be SARS-CoV-2 have not been purified, how do you want to be sure that the RNA gene sequences of these particles belong to a specific new virus?
Particularly, if there are studies showing that substances such as antibiotics that are added to the test tubes in the in vitro experiments carried out for virus detection can “stress” the cell culture in a way that new gene sequences are being formed that were not previously detectable — an aspect that Nobel laureate Barbara McClintock already drew attention to in her Nobel Lecture back in 1983.
It should not go unmentioned that we finally got the Charité – the employer of Christian Drosten, Germany’s most influential virologist in respect of COVID-19, advisor to the German government and co-developer of the PCR test which was the first to be “accepted” (not validated!) by the WHO worldwide – to answer questions on the topic.
But we didn’t get answers until June 18, 2020, after months of non-response. In the end, we achieved it only with the help of Berlin lawyer Viviane Fischer.
Regarding our question “Has the Charité convinced itself that appropriate particle purification was carried out?,” the Charité concedes that they didn’t use purified particles.
And although they claim “virologists at the Charité are sure that they are testing for the virus,” in their paper (Corman et al.) they state:
RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany),”
Which means they just assumed the RNA was viral.
Incidentally, the Corman et al. paper, published on January 23, 2020 didn’t even go through a proper peer review process, nor were the procedures outlined therein accompanied by controls — although it is only through these two things that scientific work becomes really solid.
Irrational test results
It is also certain that we cannot know the false positive rate of the PCR tests without widespread testing of people who certainly do not have the virus, proven by a method which is independent of the test (having a solid gold standard).
Therefore, it is hardly surprising that there are several papers illustrating irrational test results.
For example, already in February the health authority in China’s Guangdong province reported that people have fully recovered from illness blamed on COVID-19, started to test “negative,” and then tested “positive” again.
A month later, a paper published in the Journal of Medical Virology showed that 29 out of 610 patients at a hospital in Wuhan had 3 to 6 test results that flipped between “negative”, “positive” and “dubious”.
A third example is a study from Singapore in which tests were carried out almost daily on 18 patients and the majority went from “positive” to “negative” back to “positive” at least once, and up to five times in one patient.
Even Wang Chen, president of the Chinese Academy of Medical Sciences, conceded in February that the PCR tests are “only 30 to 50 per cent accurate”; while Sin Hang Lee from the Milford Molecular Diagnostics Laboratory sent a letter to the WHO’s coronavirus response team and to Anthony S. Fauci on March 22, 2020, saying that:
It has been widely reported in the social media that the RT-qPCR [Reverse Transcriptase quantitative PCR] test kits used to detect SARSCoV-2 RNA in human specimens are generating many false positive results and are not sensitive enough to detect some real positive cases.”
In other words, even if we theoretically assume that these PCR tests can really detect a viral infection, the tests would be practically worthless, and would only cause an unfounded scare among the “positive” people tested.
This becomes also evident considering the positive predictive value (PPV).
The PPV indicates the probability that a person with a positive test result is truly “positive” (ie. has the supposed virus), and it depends on two factors: the prevalence of the virus in the general population and the specificity of the test, that is the percentage of people without disease in whom the test is correctly “negative” (a test with a specificity of 95% incorrectly gives a positive result in 5 out of 100 non-infected people).
With the same specificity, the higher the prevalence, the higher the PPV.
In this context, on June 12 2020, the journal Deutsches Ärzteblatt published an article in which the PPV has been calculated with three different prevalence scenarios.
The results must, of course, be viewed very critically, first because it is not possible to calculate the specificity without a solid gold standard, as outlined, and second because the calculations in the article are based on the specificity determined in the study by Jessica Watson, which is potentially worthless, as also mentioned.
But if you abstract from it, assuming that the underlying specificity of 95% is correct and that we know the prevalence, even the mainstream medical journal Deutsches Ärzteblatt reports that the so-called SARS-CoV-2 RT-PCR tests may have “a shockingly low” PPV.
In one of the three scenarios, figuring with an assumed prevalence of 3%, the PPV was only 30 percent, which means that 70 percent of the people tested “positive” are not “positive” at all. Yet “they are prescribed quarantine,” as even the Ärzteblatt notes critically.
In a second scenario of the journal’s article, a prevalence of rate of 20 percent is assumed. In this case they generate a PPV of 78 percent, meaning that 22 percent of the “positive” tests are false “positives.”
That would mean: If we take the around 9 million people who are currently considered “positive” worldwide — supposing that the true “positives” really have a viral infection — we would get almost 2 million false “positives.”
All this fits with the fact that the CDC and the FDA, for instance, concede in their files that the so-called “SARS-CoV-2 RT-PCR tests” are not suitable for SARS-CoV-2 diagnosis.
In the “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel“ file from March 30, 2020, for example, it says:
Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms”
And:
This test cannot rule out diseases caused by other bacterial or viral pathogens.”
And the FDA admits that:
positive results […] do not rule out bacterial infection or co-infection with other viruses. The agent detected may not be the definite cause of disease.”
Remarkably, in the instruction manuals of PCR tests we can also read that they are not intended as a diagnostic test, as for instance in those by Altona Diagnostics and Creative Diagnostics[5].
To quote another one, in the product announcement of the LightMix Modular Assays produced by TIB Molbiol — which were developed using the Corman et al. protocol — and distributed by Roche we can read:
These assays are not intended for use as an aid in the diagnosis of coronavirus infection”
And:
For research use only. Not for use in diagnostic procedures.”
Where is the evidence that the tests can measure the “viral load”?
There is also reason to conclude that the PCR test from Roche and others cannot even detect the targeted genes.
Moreover, in the product descriptions of the RT-qPCR tests for SARS-COV-2 it says they are “qualitative” tests, contrary to the fact that the “q” in “qPCR” stands for “quantitative.” And if these tests are not “quantitative” tests, they don’t show how many viral particles are in the body.
That is crucial because, in order to even begin talking about actual illness in the real world not only in a laboratory, the patient would need to have millions and millions of viral particles actively replicating in their body.
That is to say, the CDC, the WHO, the FDA or the RKI may assert that the tests can measure the so-called “viral load,” i.e. how many viral particles are in the body. “But this has never been proven. That is an enormous scandal,” as the journalist Jon Rappoport points out.
This is not only because the term “viral load” is deception. If you put the question “what is viral load?” at a dinner party, people take it to mean viruses circulating in the bloodstream. They’re surprised to learn it’s actually RNA molecules.
Also, to prove beyond any doubt that the PCR can measure how much a person is “burdened” with a disease-causing virus, the following experiment would have had to be carried out (which has not yet happened):
You take, let’s say, a few hundred or even thousand people and remove tissue samples from them. Make sure the people who take the samples do not perform the test.The testers will never know who the patients are and what condition they’re in. The testers run their PCR on the tissue samples. In each case, they say which virus they found and how much of it they found. Then, for example, in patients 29, 86, 199, 272, and 293 they found a great deal of what they claim is a virus. Now we un-blind those patients. They should all be sick, because they have so much virus replicating in their bodies. But are they really sick — or are they fit as a fiddle?
With the help of the aforementioned lawyer Viviane Fischer, I finally got the Charité to also answer the question of whether the test developed by Corman et al. — the so-called “Drosten PCR test” — is a quantitative test.
But the Charité was not willing to answer this question “yes”. Instead, the Charité wrote:
If real-time RT-PCR is involved, to the knowledge of the Charité in most cases these are […] limited to qualitative detection.”
Furthermore, the “Drosten PCR test” uses the unspecific E-gene assay as preliminary assay, while the Institut Pasteur uses the same assay as confirmatory assay.
According to Corman et al., the E-gene assay is likely to detect all Asian viruses, while the other assays in both tests are supposed to be more specific for sequences labelled “SARS-CoV-2”.
Besides the questionable purpose of having either a preliminary or a confirmatory test that is likely to detect all Asian viruses, at the beginning of April the WHO changed the algorithm, recommending that from then on a test can be regarded as “positive” even if just the E-gene assay (which is likely to detect all Asian viruses!) gives a “positive” result.
This means that a confirmed unspecific test result is officially sold as specific.
That change of algorithm increased the “case” numbers. Tests using the E-gene assay are produced for example by Roche, TIB Molbiol and R-Biopharm.
High Cq values make the test results even more meaningless
Another essential problem is that many PCR tests have a “cycle quantification” (Cq) value of over 35, and some, including the “Drosten PCR test”, even have a Cq of 45.
The Cq value specifies how many cycles of DNA replication are required to detect a real signal from biological samples.
“Cq values higher than 40 are suspect because of the implied low efficiency and generally should not be reported,” as it says in the MIQE guidelines.
MIQE stands for “Minimum Information for Publication of Quantitative Real-Time PCR Experiments”, a set of guidelines that describe the minimum information necessary for evaluating publications on Real-Time PCR, also called quantitative PCR, or qPCR.
The inventor himself, Kary Mullis, agreed, when he stated:
If you have to go more than 40 cycles to amplify a single-copy gene, there is something seriously wrong with your PCR.”
The MIQE guidelines have been developed under the aegis of Stephen A. Bustin, Professor of Molecular Medicine, a world-renowned expert on quantitative PCR and author of the book A-Z of Quantitative PCR which has been called “the bible of qPCR.”
In a recent podcast interview Bustin points out that “the use of such arbitrary Cq cut-offs is not ideal, because they may be either too low (eliminating valid results) or too high (increasing false “positive” results).”
And, according to him, a Cq in the 20s to 30s should be aimed at and there is concern regarding the reliability of the results for any Cq over 35.
If the Cq value gets too high, it becomes difficult to distinguish real signal from background, for example due to reactions of primers and fluorescent probes, and hence there is a higher probability of false positives.
Moreover, among other factors that can alter the result, before starting with the actual PCR, in case you are looking for presumed RNA viruses such as SARS-CoV-2, the RNA must be converted to complementary DNA (cDNA) with the enzyme Reverse Transcriptase—hence the “RT” at the beginning of “PCR” or “qPCR.”
But this transformation process is “widely recognized as inefficient and variable,” as Jessica Schwaber from the Centre for Commercialization of Regenerative Medicine in Toronto and two research colleagues pointed out in a 2019 paper.
Stephen A. Bustin acknowledges problems with PCR in a comparable way.
For example, he pointed to the problem that in the course of the conversion process (RNA to cDNA) the amount of DNA obtained with the same RNA base material can vary widely, even by a factor of 10 (see above interview).
Considering that the DNA sequences get doubled at every cycle, even a slight variation becomes magnified and can thus alter the result, annihilating the test’s reliable informative value.
So how can it be that those who claim the PCR tests are highly meaningful for so-called COVID-19 diagnosis blind out the fundamental inadequacies of these tests—even if they are confronted with questions regarding their validity?
Certainly, the apologists of the novel coronavirus hypothesis should have dealt with these questions before throwing the tests on the market and putting basically the whole world under lockdown, not least because these are questions that come to mind immediately for anyone with even a spark of scientific understanding.
Thus, the thought inevitably emerges that financial and political interests play a decisive role for this ignorance about scientific obligations. NB, the WHO, for example has financial ties with drug companies, as the British Medical Journal showed in 2010.
And experts criticize “that the notorious corruption and conflicts of interest at WHO have continued, even grown“ since then. The CDC as well, to take another big player, is obviously no better off.
Finally, the reasons and possible motives remain speculative, and many involved surely act in good faith; but the science is clear: The numbers generated by these RT-PCR tests do not in the least justify frightening people who have been tested “positive” and imposing lockdown measures that plunge countless people into poverty and despair or even drive them to suicide.
And a “positive” result may have serious consequences for the patients as well, because then all non-viral factors are excluded from the diagnosis and the patients are treated with highly toxic drugs and invasive intubations. Especially for elderly people and patients with pre-existing conditions such a treatment can be fatal, as we have outlined in the article “Fatal Therapie.”
Without doubt eventual excess mortality rates are caused by the therapy and by the lockdown measures, while the “COVID-19” death statistics comprise also patients who died of a variety of diseases, redefined as COVID-19 only because of a “positive” test result whose value could not be more doubtful.
NOTES:-
[1] Sensitivity is defined as the proportion of patients with disease in whom the test is positive; and specificity is defined as the proportion of patients without disease in whom the test is negative.
[2] E-mail from Prof. Thomas Löscher from March 6, 2020
[3] Martin Enserink. Virology. Old guard urges virologists to go back to basics, Science, July 6, 2001, p. 24
[4] E-mail from Charles Calisher from May 10, 2020
[5] Creative Diagnostics, SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit
This article is great but how do we know that the emails from those professors are legit?
Also shouldn’t the main question about all this be what on earth are they doing with all the DNA ? If the PCR is replicating DNA sequences million and billions of times rapidly…. is this being used to clone humans?
What evidence is there to suggest Mullis regarded the PCR as inappropriate to detect a viral infection? How can we be certain he wouldn’t of been part of the problem also… just curious about the validity in Mullis himself.. thanks.
As we are learning more about the subject. It is like Socrates aphorisms “ All I know, is , that I Know nothing “.
This was so wonderful!!!!!!!!! Thank you so much for this hard work!!! You are saving the world with this work (literally). May God bless you abundantly and you both will be so blessed because of this work. I have been saying this since February and no one wanted to believe me.
great article. thank you.
an update / next level / 2021
https://www.bibliotecapleyades.net/ciencia3/ciencia_coronavirus85.htm
“In Liechtenstein, the Principality is financially supporting a medical study called “COVI-GAPP” by the Swiss medical testing firm Labormedizinisches Zentrum Dr. Risch.
In this voluntary trial, 2,200 persons (about 5% of tiny Liechtenstein’s population) are being given “Ava”-brand bracelets to determine whether these wearables can identify COVID-19 pre-symptomatic cases (i.e. before the patient shows any symptoms).
The bracelets, which were supplied by Swiss fertility start-up Ava, are worn at night and record biometric data such as movements, body temperature, blood flow, breath, and pulse rate. ”
In most countries getting basic medical care is a challenge and these bozos are off again to find the magic device that people can stare for ours as they download the latest update for its software.
Good nutrition, exercise and being smart can guarantee better health in old age than most experience today in the West.
No virus satisfies Koch’s postulates.
Vaccines for viral infections were developed by Pasteur and Jenner before they were sure of their existence!
Did they make viruses up? I doubt it. They inferred their existence from circumstantial evidence. When filters with pores small enough to trap bacteria were ineffective in preventing the sap from diseased tobacco plants infecting healthy ones, thus ruling out bacteria, the first clue was acquired.
Contrary to popular opinion, most legal convictions are made on the basis of circumstantial evidence. I think it is the same for scientific convictions.
In 1940, the first electron micrograph of a bacteriophage (a virus infecting bacteria) was published and this silenced sceptics who had argued that bacteriophages were relatively simple enzymes and not viruses.
The tobacco mosaic virus, the first virus to be discovered was also the first to be crystallized and its structure shown in full detail in 1951 by none other than Rosalind Franklin who did the same for DNA. We no longer need to take pictures of DNA molecules in order to carry out genetic fingerprinting.
The image of the “virus” budding from an infected cell, is in fact an image of an exosome. These were once thought to be “garbage bags” for cells but are now also known to play a role in cellular communication , transfer of bioactive molecules, and immune modulation. They carry molecules of cellular origin – proteins, lipids and RNAs.
However, viruses can “hijack the exosome pathway by directly interfering with the machinery involved in exosome biogenesis”
How do they know that the RNA from the exosome is from a virus and not cellular in origin? I suspect its because the sequence matches closely enough to known coronaviruses that have had their pictures taken and doesn’t match humans.
What is the real reason we don’t have a picture of Covid-19?
Is it because, as Professor Luc Montagnier, French Nobel Prize winner and co-discoverer of HIV, claimed, the Covid-19 virus is partially lab grown and that his research revealed that it contains small sequences from HIV, the AIDS virus?
That it was in fact, a viral-vector vaccine gone rogue.
The Professor also stated he believed that the genetic inserts from HIV applied to the coronavirus would gradually disappear as the virus mutated. Thus, it may well have been quite deadly in the early stages and became less and less severe as more and more people contracted it.
Thus, it would be in the interests of those who engineered the virus to wait until the inserts had played out before releasing detailed images of its structure.
It would also be in the interests of the same to create confusion and statistical distortion through the initial faulty PCR testing focused on the elderly and frail, skewed towards false positives and delaying the roll out of the antibody tests in the general population, which are skewed towards false negatives, but still reveal the true extent of infection, which drives down the severity of the virus – the case fatality rate and thus the purported motivation for the orchestrated plandemic.
as I stated below- wrong! on viruses and Koch – hopefully u can pronounce that name 😁
chicken pox does! and very effectively too
anyone with children who are pre-chiken pox useless vakseen know that very well!
As for Luc – he has never isolated/purified HIV and so his AIDS achieved fame shared with that mobster Galo is very problematic.
Kerry Mullins himself exposed HIV con PCR testing as can be seen in his very revealing interview, which started his official demise along with Peter Duisburg.
Unconvincing
And not even completely necessary. Even Koch himself thought so:
“Koch abandoned the requirement of the first postulate altogether when he discovered asymptomatic carriers of cholera.”
https://bio.libretexts.org/Bookshelves/Microbiology/Book%3A_Microbiology_(Boundless)/10%3A_Epidemiology/10.1%3A_Principles_of_Epidemiology/10.1E%3A_Exceptions_to_Koch%E2%80%99s_Postulates
This is quite the contradiction!
The first postulate set out by Koch is ‘The microorganism must be found in the diseased animal, and not found in healthy animals.’, therefore how can someone be “asymptomatic”? If someone is healthy and carrying the “virus”, then we can deduce the virus is not the cause of the disease. It also contradicts the third postulate which states ‘The microorganism must cause disease when introduced to a HEALTHY experimental animal.’, this again shows the hypocrisy that someone can be “asymptomatic”.The viruses either causes the disease or it has nothing to do with it, simple. Germ theory is founded on these very common sense principles to prove “viruses” cause disease (which they don’t). Not one scientist has ever satisfied any of these principles for which are their gold standard. Not one scientist has proven that even bacteria cause disease. Many experiments have been done in the old days to try an infect people with bacteria and viruses and none ever worked. Electron micrographs don’t provide any evidence of anything because there is no context to what is being captured, especially after the treatment a sample goes through to have it prepared before being photographed, causing further changes to said sample. Scientists work in labs, which have no resemblance to the real world. They test on animals which are NOT human beings.
The word “virus” is latin for poison, which is exactly what creates dis-ease in men/women (and animals). Enviromental toxins caused by industrial wastes, pesticides, poor diet, synthetic drugs/vitamins/minerals, vaccines, polluted drinking water, poverty, living conditions, petrochemicals in nearly all body/hair products, radio frequencies, EMF smog, pollution and the list goes on and on and on.
Read a book called ‘What Really Makes you Ill’ by Dawn Lester and David Parker. This book took them 10 years to complete and is comprehensive. I urge you take a read.
First, Koch’s postulates are not the gospel. He showed this by abandoning his own first postulate.
Second, someone is asymptomatic when they don’t show symptoms. This doesn’t necessarily mean they are healthy. A symptom such as a fever may be a sign of good health.
The third postulate is not as you misquoted. Here is the correct version:
“The cultured microorganism should cause disease when introduced into a healthy organism.”
Should.
Koch found that not all organisms exposed to an infectious agent will acquire the infection. This means that some did.
What does this show?
It shows that Koch was not as pedantic as he is made out to be.
The point being is germ theory uses these sets of postulates as their gold standard and even setup an institution named after Koch. So you cannot say that these postulates are not gospel when they are still used as the gold standard, even to this day. If this is outdated and there is evidence to the contrary why have they not setup a new set of postulates or gold standard? “scientists” are now just deciding for themselves what the “standard” should be and mixing and matching to fit their narrative in the hope to find some virus.
Being argumentative about what the actual postulate says, serves what purpose? What I quoted means the same as what you quoted with a slight change in wording.
So by definition it cannot be ‘infectious’ if not all organisms who were exposed to the agent got sick, meaning that the agent itself was not the cause of disease.
The word ‘asymptomatic’ is an excuse to fool people, because germ theory is bogus. The word ‘disease’ means exactly that, “dis-ease”. If the body is not in dis-ease, then you are not sick. Of course toxins can build up in the body and when the body is completely overloaded you will show signs of “fever”, pustules, rashes etc. Generally the body can get rid of a lot of these toxins very efficiently, but we live in a world as I explained in my previous comment, whereby we are swimming in toxicity. How the body is able to survive as long as it does with this kind of bombardment is a testament to it’s magnificence.
To say viruses cause disease is like saying firefighters are the cause of the fire. Every human is made up of approximately 50% virus. The word virus should be abandoned completely because these things we call viruses are the communication system between us and the entire world around us.
Germ theory is a commercial enterprise to make profit. They couldn’t care less about health.
“Being argumentative about what the actual postulate says, serves what purpose?”
Must replaced with should completely changes the argument.
It serves the purpose of showing that the best science is not pedantic. We should not be pedantic either. That is the purpose.
“So by definition it cannot be ‘infectious’ if not all organisms who were exposed to the agent got sick, meaning that the agent itself was not the cause of disease.”
From Koch’s viewpoint, “infectious” means that the virus has found its way into at least one of the host’s cells, through to the nucleus and has begun to replicate. As it replicates it results in damage to the host. If enough cells are infected then lots of damaged and dead cells result. Then the immune response to attack its own infected cells and clear away the dead cells results itself in collateral damage of healthy cells.In immuno-compromised individuals the cytokine storm can be lethal.
This whole process can be cut short if the virus is not too severe and/or the host has a healthy terrain and developed immune system. It does not replicate enough to cause noticeable symptoms or “disease”.
I think the word “asymptomatic” means just that, no symptoms or least no symptoms detected.
I don’t think germ theory is bogus, I just think it’s not the full picture. I think terrain theory completes the picture. Terrain theory does not deny the existence of germs, it places them into the ecosystem of the organism and its inner and outer environment.
“The word ‘asymptomatic’ is an excuse to fool people, because germ theory is bogus. The word ‘disease’ means exactly that, “dis-ease”. If the body is not in dis-ease, then you are not sick.”
On his deathbed Louis Pasteur is purported to have said: “Bernard was correct. I was wrong. … The microbe is nothing, the soil is everything.”
I don’t think he was denying germ theory but putting it into its correct context. Equally I don’t think Koch was trying to pull a fast one on everyone.
“Of course toxins can build up in the body and when the body is completely overloaded you will show signs of “fever”, pustules, rashes etc. Generally the body can get rid of a lot of these toxins very efficiently, but we live in a world as I explained in my previous comment, whereby we are swimming in toxicity. How the body is able to survive as long as it does with this kind of bombardment is a testament to it’s magnificence.”
I agree with this, but none of it proves the non-existence of germs or their effect on the body.
“To say viruses cause disease is like saying firefighters are the cause of the fire. Every human is made up of approximately 50% virus. The word virus should be abandoned completely because these things we call viruses are the communication system between us and the entire world around us.”
I agree and would add that the real pyro-maniac firefighters are the over-triggered immune system.
I also agree that we have a whole virome and a small percentage of viruses can be harmful. Agent provocateurs rather than pyro-maniac firefighters are a better analogy.
“Germ theory is a commercial enterprise to make profit. They couldn’t care less about health.”
I agree that it has been over-emphasized to make profit for commercial enterprise but don’t agree that it was invented that way from scratch. Commercial enterprise also exploits terrain theory for private gain and power. Look at how ecosystems outside and inside of us are under an invisible siege.That doesn’t mean terrain theory is bogus either.
pasteur was admitting he falsified his research. one of his descendents revealed he had conducted a fraud. the germ is nothing means it is a complete distraction from what actually helps people. the terrain being good health. this is the inner terrain being well nourished, cleansed and regenerated. asymptomatic is constructed from germ theory. it is simply terrorist lingo used to attack people and spread anti social behavior, fear, terror, toxic treatments, crimes against humanity etc.
should (sho͝od)
aux.v. Past tense of shall
1. Used to express obligation or duty: You should send her a note.
2. Used to express probability or expectation: They should arrive at noon.
3. Used to express conditionality or contingency: If she should fall, then so would I.
4. Used to moderate the directness or bluntness of a statement: I should think he would like to go.
shall (shăl)
aux.v. Past tense should (sho͝od)
1. Used before a verb in the infinitive to show:
a. Something that will take place or exist in the future: We shall arrive tomorrow.
b. An order, promise, requirement, or obligation: You shall leave now. He shall answer for his misdeeds. The penalty shall not exceed two years in prison.
c. The will to do something or have something take place: I shall go out if I feel like it.
d. Something that is inevitable: That day shall come.
2. Archaic
a. To be able to.
b. To have to; must.
must [ muhst ]
auxiliary verb1 to be obliged or bound to by an imperative requirement:
I must keep my word.
2 to be under the necessity to; need to:
Animals must eat to live.
3 to be required or compelled to, as by the use or threat of force:
You must obey the law.
Exactly
SYNONYMS FOR MUST
1Must, ought, should express necessity or duty. Must expresses necessity or compulsion: I must attend to those patients first. Soldiers must obey orders. Ought (weaker than must ) expresses obligation, duty, desirability: You ought to tell your mother. Should expresses obligation, expectation, or probability: You are not behaving as you should. Children should be taught to speak the truth. They should arrive at one o’clock.
You make a fair point about “should” vs “must”.
I would have to disagree and say that scientists must absolutely be pedantic. To understand how things work you must go through everything with a fine tooth comb, no stone unturned. Without being pedantic we end up in the position we are in, where the the world has gone mad based on bad science.
“From Koch’s viewpoint, “infectious” means that the virus has found its way into at least one of the host’s cells, through to the nucleus and has begun to replicate. As it replicates it results in damage to the host. If enough cells are infected then lots of damaged and dead cells result. Then the immune response to attack its own infected cells and clear away the dead cells results itself in collateral damage of healthy cells.In immuno-compromised individuals the cytokine storm can be lethal.”
From my research not one scientist has explained the mechanism in how a virus enters the body and into a host cell. Explain how genetic material wrapped in a protein case, which that in itself is benign, enter the body, bypassing all the other defence mechanisms of the body, like bacteria on our skin, mucus barriers, and digestive tract (full of other bacteria i.e. immune system) and somehow after all that can then make you ill. It’s just genetic material, which is just information. The works of Bechamp, Enderlein, Naessens and other contemporaries of Bechamp found that these “germs” were already in the body and stemmed from Microzymas and depending on the terrain of the body would depend on what these organisms morphed into i.e. pleomorphism.
“On his deathbed Louis Pasteur is purported to have said: “Bernard was correct. I was wrong. … The microbe is nothing, the soil is everything.””
You wrote “Bernard” but was Pasteur was referring to Antoine Bechamp. I agree completely the terrain is everything. The terrain theory makes sense completely. Mankind has forgotten that we are born from the Earth and that we inherently have all the mechanisms in place to live in harmony with nature. The Microzymas Bechamp discovered (although indirectly) are found everywhere. He first discovered them inside of chalk millions of years old. They are found in all animal and plant life. What we call viruses might just be the information mechanism in which all life communicates and evolves and not this deadly threat which the mainstream is perpetuating.
“I agree with this, but none of it proves the non-existence of germs or their effect on the body.”
As explained above I do not deny microorganisms or their effect on the body, but I do believe that it is dependent on the health of the body which determine what the microorganisms do. It’s nothing to do with an external bacterial or viral “attack”. Bacteria are the recyclers of the planet, they break down dying material. So the same goes for when the body is in a dying state caused by all sorts of environmental toxins (but not limited to i.e. Unhealthy mental state). So when the body sends out the signal to repair these organisms change to recycle or rid the dead cells or toxins.
“I agree and would add that the real pyro-maniac firefighters are the over-triggered immune system.”
The immune system is not “pyro-maniac”, it just respond to the condition/terrain of the body. It can only handle so much toxicity. The body has been been confused with the levels of toxicity it is bombarded with. Why do we blame the body for doing what it was designed to do? Terrain theory sensibly explains and makes complete sense of what the body is doing.
“I agree that it has been over-emphasized to make profit for commercial enterprise but don’t agree that it was invented that way from scratch. Commercial enterprise also exploits terrain theory for private gain and power. Look at how ecosystems outside and inside of us are under an invisible siege.That doesn’t mean terrain theory is bogus either.”
Maybe not have been intended from the beginning but was hijacked very early on with the realisation that it could be exploited for commercial gains. Like you say, the establishment has sold mankind that this invisible entity is at war with us and we need to destroy it and the only way to save us is with a vaccine.
“I would have to disagree and say that scientists must absolutely be pedantic. To understand how things work you must go through everything with a fine tooth comb, no stone unturned. Without being pedantic we end up in the position we are in, where the the world has gone mad based on bad science.”
Au contraire. Let us not confuse pedantic with scrupulous. A pedantic scientist is trapped in one paradigm, looking at one stone obsessively, deriding anyone who looks at other stones. Insecure and covering up with a show of arrogance to hide their ignorance. This form of madness has led to the position we are in today.
The great advances in science have come through the opposite approach to pedantic obsessions, by looking at the other stones as well, seeing a pebble beach perhaps rather than a collection of pebbles.
“From my research not one scientist has explained the mechanism in how a virus enters the body and into a host cell. Explain how genetic material wrapped in a protein case, which that in itself is benign, enter the body, bypassing all the other defence mechanisms of the body, like bacteria on our skin, mucus barriers, and digestive tract (full of other bacteria i.e. immune system) and somehow after all that can then make you ill.”
Scientists have explained this over and over, you simply haven’t accepted their explanations. I would say that genetic material wrapped in protein and lipids, sometimes, but not always, bypass the body’s defence mechanisms -why would the body need to have evolved “defence mechanisms” if nothing ever got through and caused illness? They get into host cells in the same way exosomes get through, interacting with membrane receptors which are also proteins and then fusing with the membrane, penetration or endocytosis.
“It’s just genetic material, which is just information.”
Just information… the same information that instructs every cell to make proteins that perform all the functions, determine features etc. The question should be how does the genetic information contained in our own DNA, identical throughout the body, tell a cell to be a brain cell rather than a skin cell or grow an arm rather than a leg and a leg rather than an arm?
If a virus can interfere with that DNA code or impose its own code, as they are purported to do, then of course it can disrupt the functioning of the cell.
The works of Bechamp, Enderlein, Naessens and other contemporaries of Bechamp found that these “germs” were already in the body and stemmed from Microzymas and depending on the terrain of the body would depend on what these organisms morphed into i.e. pleomorphism.”
Microzymas sound a lot like viruses, the “living genes” that form the basis of life according to the above-named gentleman, especially in the way that Lynn Margulis viewed them. They also resemble the Bions of Wilhelm Reich.
“You wrote “Bernard” but Pasteur was referring to Antoine Bechamp.”
Pasteur was purportedly referring to Claude Bernard who obtained his theory from Bechamp.
“I agree completely the terrain is everything. The terrain theory makes sense completely. Mankind has forgotten that we are born from the Earth and that we inherently have all the mechanisms in place to live in harmony with nature. The Microzymas Bechamp discovered (although indirectly) are found everywhere. He first discovered them inside of chalk millions of years old. They are found in all animal and plant life. What we call viruses might just be the information mechanism in which all life communicates and evolves and not this deadly threat which the mainstream is perpetuating.”
Agreed, I find Bechamp’s work fascinating.
“As explained above I do not deny microorganisms or their effect on the body, but I do believe that it is dependent on the health of the body which determine what the microorganisms do. It’s nothing to do with an external bacterial or viral “attack”. Bacteria are the recyclers of the planet, they break down dying material. So, the same goes for when the body is in a dying state caused by all sorts of environmental toxins (but not limited to i.e. Unhealthy mental state). So when the body sends out the signal to repair these organisms change to recycle or rid the dead cells or toxins.
I agree up to a point but predators, scavengers and parasites are also part of nature’s harmony. Perhaps a small percentage of the micro-organism’s job is to remove not just toxins and cells, but also weak and dying organisms. This keeps the herd healthy as a whole.
“The immune system is not “pyro-maniac”, it just respond to the condition/terrain of the body. It can only handle so much toxicity. The body has been been confused with the levels of toxicity it is bombarded with. Why do we blame the body for doing what it was designed to do? Terrain theory sensibly explains and makes complete sense of what the body is doing.”
The healthy immune system is not but a toxic terrain can drive it insane so it attacks its own organism. Vaccines, particularly coronavirus vaccines, have this effect. RNA/DNA vaccines seem to have been designed for this very purpose. Also bio-engineered viruses which seem to be no different from viral-vector vaccines.
Maybe not have been intended from the beginning but was hijacked very early on with the realisation that it could be exploited for commercial gains. Like you say, the establishment has sold mankind that this invisible entity is at war with us and we need to destroy it and the only way to save us is with a vaccine.
Agreed but I would add that the upper echelons of the establishment are aware that this is a scam and perhaps even subscribe to terrain theory, which they exploit for population control – suppressing the masses through deliberate pollution of the inner and outer environment.
stefan lanka said koch introduced the fraud that the 3rd postulate only needed to show a similar disease ie. they could then poison the ingredients to show it made people have some “disease”. the earlier postulates required same symptoms.
Other researchers before Luc and after noted the HIV inserts into the spike protein coding.
Thanks for your interesting comments Dylan, especially with regard to what you wrote about Luc Montagnier. As you stated, he was not the only one who discovered this. The fact that shortly after analogous findings from other scientists were withdrawn under pressure, is quite significant.
Here’s a worthwhile analysis from another scientist:
Biotech entrepreneur Yuri Deigin details how SARS-CoV-2 may have been genetically engineered or “synthesized” in gain-of-function research, in a laboratory from which it then escaped.
https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748
He challenges the notion that the virus couldn’t be a genetically engineered lab creation because it doesn’t have a “signature” of genetic engineering and points out that all the unusual features of SARS-CoV-2 are standard targets of coronavirus gain-of-function research, of the kind carried out in the WIV lab.
Deigin also dismisses the conclusions of the Nature Medicine article that rejected the lab-made hypothesis and promoted the idea that it emerged through natural selection.
“There is no irrefutable evidence against it [the lab-made hypothesis] in the paper, just a loud ‘we don’t believe so’ based on a shaky foundation.”
“Just because CoV2 differs from some ‘optimal’ virus, doesn’t mean it could not have been created in a lab. Not the lab trying to create ‘optimal’ bioweapons, but a lab creating chimeras of naturally found strains, say, in bats and pangolins.”
Thanks again for the additional information Dylan. As a matter of fact, there are several important scientists/doctors who blew the whistle and spoke out about these gain of function studies some of which were previously subject to a moratorium! It’s like you wrote earlier ” Vaccines for viral infections were developed by Pasteur and Jenner before they were sure of their existence!” That’s what’s still happening! How likely is it that these ‘gain of function viruses’ ,made for vaccine purposes (at least, that’s what they want us to believe!), will ever emerge through natural selection? The persons involved do not question this with enough objectivity. They simply can’t because of the many conflicts of interest.
To be brutal, you could go test for about 20 viruses using PCR/RT-PCR and you would find wide levels of positive samples. Try HPVs, HSV, EBV, adenoviruses just for starters. They will all be present in many, many people. Not many of them will have a single symptom.
As for Koch’s Postulates, yes, that proof is the gold standard. But in the real world where something or other is spiking and then falling, you need to take quick action early on. The fatality curves are certainly consistent with a viral infection, namely exponential growth then rapid decline. Proving those postulates is a good thing for some academic scientists to do, away from the front line of medical treatment. The medical staff have more pressing engagements.
The biggest problem is the never ending need for politicians to ‘do something fast’.
Sometimes, doing nothing fast is the best option: doing something rigorously, then being able to do things accurately is often ultimately quicker than slapdash willy-nilly running around like headless chickens, panicking an entire population of those incapable of thinking for themselves.
No virus meet any of the 4 Postulates.
bull crap! chicken pox does and to a certain extent measles also
why certain? figure it out but here is a hint – find one report that proves its existence both under EM and with full genetic code from the same source
“The fatality curves are certainly consistent with a viral infection”
They were heavily influenced by incorrect treatment DESPITE the fact that months earlier best treatment methods were known. Highly suspicious “herding” of Positive patients with truely sick ones. Then we have the old age homes and how things were done there.
Sorry but the numbers are to some extent inflated. Something we will not be able to undo to see the real picture.
SATS-CoV2 is a geopolitical virus being played on the minds of the uninformed Public. Kids wearing those deadly masks in 28C in the Open Air is a crime !!!!
they are consistant because the cult also engineered those “fatality curves” around their “viral infection” theory. slamming a car into a wall produces consistant results. it does not prove walls are magnetic.
taking swift action is one of their many excuses. these entities are crooks that always make excuses even when they have had decades. the only action they should take is to come clean.
THANK YOU! Finally seeing some REAL Investigative Journalism! I have read up on this extensively through articles and journals. I would LOVE to know the amount of amplifications being used. (Manipulated easily)
THIS is what needs to counter the absurd narrative that is destroying businesses, livelihoods and the entire economy … across the globe. AWESOME WORK! Thanks for stepping up to the plate!!!
how do we know the info presented here is for real? i mean..this is a ‘strange’ web site, isnt it ? i am not saying this info is not correct..but..how can we know for sure?
i mean..we have to believe one side or the other..but you never know which info is fake or not (on purpose or not)
I’m no expert but based on reading all I could get my hands on to research, this information is correct and with plenty of references to boot. There are some very knowledgeable experts in the comments also.
What the “selected” experts are pushing furiously on the public is a one-sided assumption of identifying a disease, when they have not even obtained the RNA from any “virion” proved to cause a disease. Easy to see the 24/7 Fear Psyop.
The ability to manipulate a global reaction while omitting the actual scientific facts behind the testing – is disturbing.
Why is the 95% Globalist Media only allowing ONE side of a scientific view, no questioning allowed?
To top it off – take a look at the CDC’s April “Revised Definitions for COVID-19 PROBABLE CASES.” It is extremely disturbing what they now deem as a positive “CASES” … even without testing.
Check it out and put all the pieces together.
Go to CDC: Cases, Data & Surveillance.
FAQ: COVID-19 Data and Surveillance (Btm of page)
Understanding the Data
What is a COVID-19 PROBABLE CASE?
Look into ALL of the highlighted Links within this.
THIS REVISION is how the CASES are grossly inflated.
It’s not
this text ascribed to stefan lanka says professor drosden acted with intent. http://youtu.be/–bE1kVtEFs
misinterpretation of the virus part 2 https://youtu.be/MnSYe5J6nMg
Great paper. Thanks.
This paper demonstrates we have NO real evidence on what is supposedly killing us in our current Plandemic.
This debate reminds me strongly of the famous AIDS debate on HIV. If you recall the NIH in their famous announcement of the “cause” of AIDS, promised they would produce the scientific peer reviewed paper demonstrating among other things the isolation and purification of HIV.
This paper nor any other and to this day, to my knowledge was NEVER produced, This is strong evidence IMO that AIDS was, is and will be a bio weapon and HIV was a vast deception and not the “cause” of AIDS.
My working hypothesis is our current Plandemic is based on the AIDS model of public health deception for evil political intent.
http://healthyprotocols.com/2_aids.htm
yes, correct- that paper was never published and it was Kerry Mullins himself who challenged Luc M and others to produce the evidence of isolated and purified HIV and the causality of AIDS
Peter Duisburg did the same and both were officially written off.
Dear Marc Wathelet,
I have read your article here: https://www.paulcraigroberts.org/2020/03/30/marc-wathelet-a-virologist-and-specialist-in-coronaviruses-and-respiratory-diseases-explains-why-asia-was-successful-in-containing-covid-19-and-why-the-west-is-not/
You are among the voices who call for house arrest and extol the virtues of the measures taken.
You state “Our doctors and nurses proudly go into battle without the necessary protection, namely a N95/FFP2, knowing that they will become infected one after the other, falling like the soldiers of the empire…”
I find this very difficult to reconcile with the facts.
The Office of National Statistics in the UK publishes weekly registered deaths data. The latest spreadsheet, for the week ending 19th June, is available for download here: https://www.ons.gov.uk/file?uri=%2fpeoplepopulationandcommunity%2fbirthsdeathsandmarriages%2fdeaths%2fdatasets%2fweeklyprovisionalfiguresondeathsregisteredinenglandandwales%2f2020/publishedweek252020.xlsx
For under 45 year olds, compared to 2019 there have been 211 excess deaths.
How can you possibly justify the measures taken?
The ONS cautioned that deaths in these age-groups often require a coroner’s inquest to determine the cause meaning registration may happen several months after the date of death.
But these deaths when they are registered are absolutely not attributable to “covid” as the guidance here demonstrates https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/877302/guidance-for-doctors-completing-medical-certificates-of-cause-of-death-covid-19.pdf
3. Referring deaths to the coroner
*Covid-19 is an acceptable direct or underlying cause of death for the purposes ofcompleting the Medical Certificate of Cause of Death
*Covid-19 is not a reason on its own to refer a death to a coroner under theCoroners and Justice Act 2009.
*That Covid-19 is a notifiable disease under the Health Protection (Notification) Regulations 2010 does not mean referral to a coroner is required by virtue of its notifiable status.
For 45 to 65 year olds, compared again to 2019, there have been 5190 excess deaths.
Anecdotally I have a friend in this age group who has died. He did not die of “covid” but it has been put on his death certificate. I know of one other with the same story.
The vast majority of deaths have been, and continue to be in the over 65 category, suffering from dementia and in care homes, in what, in my opinion, amounts to murder by guidance.
The fear mongering by you and others has been completely out of proportion with the facts. Care home and hospital staff were made to feel mortally afraid and guidance was to go home and self isolate for 14 days at any signs of symptoms. Obviously this means they were understaffed and the guidance is clear that any suspected infected patients must be shut in a room on their own. Only visited by people wearing full PPE and not allowed visits from family or even someone to hold their hand.
With delirium being a sign of suspected “covid” infection according to guidance here: https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/886140/admission__and_care_of_residents_during_covid19_incident_in_a_care_home.pdf
I know that doctors earn significantly more money than the rest of us but I fear that it is not enough to buy ivory towers of the height you may be requiring. The peasants see through the lies and are sharpening their pitchforks.
Understand that I don’t wish any violence on anyone but with evictions and food shortages on the horizon it is not difficult to predict what may happen.
I hope you will reconsider your killer virus hypothesis.
Sincerely,
Dave
Booohh Dave, I am so scared, sharpen your pitchfork as much as you want, I am independent and have not made a cent in this crisis, and I stand by my position as it has saved lives. I never made crazy predictions like the London school, and all the predictions I made, which were for Belgium only, have been verified as correct, sorry. We have had a number of deaths in Belgium of the medical personnel, including people who were young and in good health. I cannot help you if you cannot understand that when the government has been so irresponsible as to not have strategic reserves to face a pandemic, and not close their borders and let people in unscreened and not quarantine them when the pandemic is developing, at some point the only way to avoid overwhelmed hospitals and corpses piling up in the hallways like in Spain and Italy is to ask people to stay at home to slow down the progression of the virus. You are being childish with your house arrest, your liberty stops where that of others start, life takes precedence over liberty and the pursuit of happiness. Throughout centuries the public health measure in pandemics has been isolation, because that’s the only thing that works. So you are unhappy with your government response, I get it, I am unhappy too. But what are you doing about it? Just bitching and barking up the wrong tree? I am not your enemy, you are so misguided and so sure of yourself, and yes, ripe to take part of a mob, not realising you are being played by the powers-that-be who want you in the street with your little pitchfork or your AR-15, they are salivating just at the thought I bet. Cool story, bro.
Look here, I have had discussions about this issue with plumbers, check-out assistants and warehouse operatives who employed a more sophisticated level of debate than you’re using. They were all fine people, entitled to their views, however they were not claiming to be scientists.
Are you going to address any of the points that Dave took the trouble to address to you? Frankly, how dare you repeatedly draw attention to your credentials while you refuse to engage with anything head-on, it’s simply infuriating. Your level of debate is on a par with an emotional layman, you are illogical, you are flippant, you are concern trolling. That someone of your apparent standing should debate in this manner I find really confusing and not a little disturbing.
Are you going to address any of the points Dave made?
Are you going to address anything in this article?
A2
Hi Marc,
Thank you for your reply.
You state: “I have never made crazy predictions…”
Also: “Our doctors and nurses proudly go into battle without the necessary protection, namely a N95/FFP2, knowing that they will become infected one after the other, falling like the soldiers of the empire…”
And most recently this statement: “We have had a number of deaths in Belgium of the medical personnel…”
If you think these marry up then now you are only lying to yourself.
You ask me “But what are you doing about it?”
I am telling everyone I meet that this killer virus narrative is clearly false. People are now universally in agreement as the numbers and the black and white guidelines do not lie. Some of them are very angry.
I apologise if you feel I meant to frighten you, that was not my intention. I am a peaceful man with a young family and do not wish harm on anyone.
True story brother.
young medical people died who were in good health? people in good health dont generally die. more like they were sick of the food in the hospital canteen and then terrified by the covid cults fear porn. when this led to symptoms they were given dangerous treatments leading to more dangerous treatments and death. course the young doctors were in quite a predicament because the cult was itching to prove how deadly the virus was, even for young “healthy” doctors.
I’d rather be sick, even unto death, than to give up my God given rights to a tyrannical government. When you are sick you will probably recover, when you give up your rights, that is forever (unless that is corrected, usually with force).
There IS a CONNECTION between DROSTEN and GATES Foundation prior-to AND after Event 201. This has never been made public.
Prior to Event 201 in late 2019, Christopher Elias and Christian Drosten were (and still are) part of the ‘International Advisory Board On Global Health’ (IABGH) to the German Health Ministry. Statement of the International Advisory Board on Global Health. From page 30 onward is in English. Note the names “Drosten” AND “Elias” ON PAGE 49 as per the following link:
https://globalhealth.charite.de/fileadmin/user_upload/microsites/ohne_AZ/sonstige/globalhealth/Dokumente/190607_IAB_Statement.pdf
Mr Drosten would later become the very person to propose/repurpose the RTPCR test to diagnose a “virus” – how curious – a connection to BMGF, yet again…
Also, prior to Event 201 – in July 2019, Charite University Berlin and BMGF (which established an office in Berlin a few years ago) partnered to create the document “Supporting the Next Stage of Germany’s Leadership in Global Health”, – interestingly relating to achieving ‘Sustainable Development Goal 3’ (SDG3) by 2030!!! Part of this July 2019 joint document highlights the role of think tanks – “Specialized global health think tanks could inform, assess and support strategy, strengthen thought leadership and contribute external perspectives”.
It is also interesting to note that the Gates-Elias/Charite-Drosten connection existed at IABGH before the Covid pandemic, and at least since August 2017 when the IABGH held its initial meeting. In December 2019, Charite received a donation for $86,181 “to determine incidence of hospital acquired infections during and following introduction of novel environmental cleaning agents”. Then, in March 2020, Charite University received a grant from BMGF for $249,550 “to develop diagnostics and virology tools to a rapid response to the novel 2019 coronavirus”
Both BMGF bribery links below:
https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2019/12/INV-004308
https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2020/03/INV-005971
““Supporting the Next Stage of Germany’s Leadership in Global Health”
I find this all so funny seeing how hard it is for the average person in many Western countries to even get good medical services without going bankrupt. Now suddenly the World Challenge is to keep the population of the world healthy. Only those in deep sleep would believe this.
From 2010,
“Even though coronavirus infection of humans is not normally associated with severe diseases, the identification of the coronavirus responsible for the outbreak of severe acute respiratory syndrome showed that highly pathogenic coronaviruses can enter the human population. Shortly thereafter, in Holland in 2004, another novel human coronavirus (HCoV-NL63) was isolated from a seven-month old infant suffering from respiratory symptoms. This virus has subsequently been identified in various countries, indicating a worldwide distribution. HCoV-NL63 has been shown to infect mainly children and the immunocommpromised, who presented with either mild upper respiratory symptoms (cough, fever and rhinorrhoea) or more serious lower respiratory tract involvement such as bronchiolitis and croup, which was observed mainly in younger children. In fact, HCoV-NL63 is the aetiological agent for up to 10% of all respiratory diseases. This review summarizes recent findings of human coronavirus HCoV-NL63 infections, including isolation and identification, phylogeny and taxonomy, genome structure and transcriptional regulation, transmission and pathogenesis, and detection and diagnosis.”
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2918871/
For the average Joe/Mary trying to figure out how this virus scam works is next to impossible leading to us observing a lone driver of a car wearing a mask.
shunting symptoms from one “disease” category to another is standard practice for the injection cult. dr greenberg told congress that statistics had been used inappropriately and the supposed efficacy of the polio injection was due to large changes in diagnostic criteria. in the case of measles they used immunoglbulin to suppress the effects of the injection which were not counted as measles. child mortality actualy stopped declining at the time in the usa.
There is something about this article I find very odd. It claims to quote a statement from Jon Rappoport, but that statement is apparently not from him or from anyone, it is not contained in the article they present as the source of the statement, and a web-search for it only leads to this article by Engelbrecht and Demeter. But weirder still is that this article plagiarises statements from that Rappoport article! It lifts some sentences word for word, and has other sentences that are almost the same as some of Rappoport’s.
The only reference to Rappoport made in the article is in the paragraph which reads as follows:
“That is to say, the CDC, the WHO, the FDA or the RKI may assert that the tests can measure the so-called “viral load,” i.e. how many viral particles are in the body. “But this has never been proven. That is an enormous scandal,” as the journalist Jon Rappoport points out.”
The last four words are presented as a clickable link, and this links to the following article by Rappoport:
https://blog.nomorefakenews.com/2020/04/08/corona-creating-illusion-of-pandemic-through-diagnostic-test/
As you will see, that Rappoport article does not contain those two short sentences attributed to him here. I have done a web-search for these sentences and this only returned copies of the above article by Engelbrecht and Demeter.
It is in that same Rappoport article that we find sentences that do appear in this article by Engelbrecht and Demeter, but which are presented as if they are the words of Engelbrecht and Demeter themselves, and there are also sentences in that Rappoport article that are very similar to sentences in this Engelbrecht and Demeter article. In Rappoport’s article, we read the following:
“Take five hundred people and remove tissue samples from them. The people who take the samples do NOT do the test. The testers will never know who the patients are and what condition they’re in.
The testers run their PCR on the tissue samples. In each case, they say which virus they found and HOW MUCH of it they found.
“All right, in patients 24, 46, 65, 76, 87, and 93 we found a great deal of virus.”
Now we un-blind those patients. They should all be sick, because they have so much virus replicating in their bodies. Are they sick? Are they running marathons? Let’s find out.”
And in the article above, by Engelbrecht and Demeter, we read the following:
_”You take, let’s say, a few hundred or even thousand people and remove tissue samples from them. Make sure the people who take the samples do not perform the test.The testers will never know who the patients are and what condition they’re in. The testers run their PCR on the tissue samples. In each case, they say which virus they found and how much of it they found. Then, for example, in patients 29, 86, 199, 272, and 293 they found a great deal of what they claim is a virus. Now we un-blind those patients. They should all be sick, because they have so much virus replicating in their bodies. But are they really sick — or are they fit as a fiddle?”_
They are plagiarising Rappoport, but doing so in a very odd way. In the same article they are doing this plagiarising in, they are actually linking to the article they are plagiarising from! They are presenting the link in a different part of their article than where they are plagiarising him, and they are presenting what they claim is a quote from that article, but it is not a quote from it, and when you do a web-search for it, you find that the only place it exists is in this article by them!
What on earth is going on here?
Since posting the above comment, I have discovered that Rappoport’s article does contain the sentence “That is an enormous scandal.” The context is as follows:
“This OBVIOUS vetting of the test has never been done. That is an enormous scandal. Where are the controlled test results in 500 patients, a thousand patients? Nowhere.”
Dear D Diligence!
Please allow me to answer to your comment as the author of this article, also on behalf of my co-author Konstantin Demeter. First of all, we find it remarkable that you did not criticize any content in our article and that you are not pointing out to a factua error. As for Jon Rappoport, we cannot comprehend your argument. In this regard, the following:
– We explicitly cited Rappoport and also explicitly linked his article to appreciate what he does as a journalist in this area; if we really wanted to unjustifiably copy something from him, we would hardly have done this.
– I (Torsten Engelbrecht) have been in contact with Rappoport for a long time–and my co-author Konstantin an I also wrote to Rappoport by email (before your comment on our article went online) to inform him that we have quoted him; he then wrote back to us that we had done an “excellent job.”
– We have been dealing critically with viruses and PCR for for a long time now; I (Torsten Engelbrecht) have been working on this topic for about 30 years, I am in contact with all the relevant top experts and I have also written a book about it which appeared the first time in 2006. That is to say, things that Rappoport mentions in his excellent article–like the overdue attempt being absolutely necessary in order to prove that the PCR tests can actually measure the virus load–I know since a long time.
Torsten Engelbrecht
It must be “D for Diligence”, of course. Sorry for this negligence.
Always reassuring to see dissenting authors publishing in dissenting media drawing authority from elevated expertise.
Robbobbobin! I hope we agree that speculations based on an argumentum ad hominem are out of place. Please recall what Nobel lautreate Temin stated. “When an experiment is challenged no matter who it is challenged by, it’s your responsibility to check. That is an ironclad rule of science.”
The only thing that matters also in this PCR context is the “wrestling” for the facts – to make living together on this planet as just and peaceful as possible.
No ad hominems involved. You wouldn’t be one of those homines who incorporates their expressed mindsets into their actual persons, would you?
Nobel laureate, eh? Good thing he wasn’t a ‘no matter’ who didn’t have any such authority to validate his truism. Whoops…
Unfortunately, you are on the “ad hominem” trip again, and you don’t seem to notice it or don’t want to. One can only agree with what RJD wrote on June 29 at 2:39: “It’s always hilarious to see comments like this… because comments like this do NOT address or even attempt to argue against a single argument or fact put forward in the article.”
Mr Diligence,
I’ve held back your last comment. It’s a bit of a mucky exchange to conduct in public.
I must say that I do not understand your points at all. The author has politely and, to my mind, completely satisfactorily addressed your concerns. If Rappoport doesn’t have a problem I can’t see for the life of me what your concern is.
Please email OffG with any further concerns, and we’ll pass these on to the authors. Thanks. A2
0980297605_text.pmd
Viruses do not exist! When you read the publication I sent you they will understand you! A pandemic is a scam! Most patients are resistant to antibiotics, some have heavy metal poisoning, some have brucellosis, some suffer from tuberculosis, some have diseases caused by vaccination, taking allopathic drugs, some have diseases due to inadequate nutrition by blood groups. in a word, the situation is very complicated and it will be even worse. Because medicine rests on the wrong pseudo-scientific foundations.
It is amusing to read Darko DD writing viruses do not exist, having spent my entire professional career working with multiple viruses of almost all the viral families, purifying them with various techniques, sequencing their genome, manipulating them to express various proteins, it is a little bit as if you were told that the place you live, your state, your country does not exist. Granted, the virus are tiny and not as easy to see, but that’s why we have science to investigate the very small. How do you know that viruses do not exist? What do you base your opinion on? Why don’t you go to your local university and ask for a tour of a virology lab, they will show you how they purify viruses and you end up with a visible pellet of the little bastards, that you can then analyse in many different ways.
It’s curious that you say this about viruses. I was led to this article from another article titled “Dismantling the Virus Theory” by Dr. Stephan Lanka, March 24, 2020. You might want to send your proof to him. Let us know how that goes.
I have zero need to go to that Dr. Lanka or anyone to prove anything. If someone comes to you and say the earth is flat or what not, do you feel the need to prove them wrong? Not me, I smile and wave. You think virus do not exist? Fine, no problem. There are real important problems on earth that are going to be hard to tackle, so that’s what I spend my energy on, not trying to convince people with deluded theories about what can be proved in a lab.
Please,just read publication in attach link on my comment. I am DVM. Thanks!
Ok, I started reading and I got a few of the ideas so far. The first is that the health of the individual is a factor in the progression of the disease. While this is being neglected by big Pharma and the powers-that-be, not a doctor or scientist would dispute this basic, extremely well established fact if they have any sense. Second, we can argue the definition of diseases and yes there is a continuum and overlap etc., so you can say diseases don’t exist, but it is semantic/philosophical and the medical doctor has a patient who asks what he has and wants a name. What are they suppose to do? I read the criticism of Pasteur and there are very few big names in science that if you go put everything under a microscope, you find thing that are wrong or anti-scientific or fraud or what not. Ok, fine, so what? That does not mean the theory is wrong. So Pasteur and Béchamp traded insults, and with the hindsight I can tell you they are both wrong on the molds… I might keep reading but you know, that does not disprove viruses whatsoever. You isolate one, amplify it by cell culture, purify it until is really pure, analyse the virion’s proteins, lipid, nucleic acid, sequence the genome, infect healthy animals with the virus and cause disease (and worse disease in unhealthy animals). You can find out that a specific viral protein is the one making the animal species sick, then go mutate that protein in the genome of the virus to create the same virus with an inactivating mutation for the specific viral protein and lo and behold when you produce that mutant virus and infect animals, they don’t get sick or much less as compared to the original virus. This has been done for many viruses and you should know that as a DVM. So it is baffling to me you still deny the existence of viruses. Proving Pasteur is a lying plagiarising prick has no impact on whether viruses exist.
Marc, I’m curious, do you add vero cells and antibiotics (or anything else for that matter) when ‘isolating’ a virus? Or did you take an unadultered sample, put it under the electron microscope and actually isolate from that? If you had added anything to the sample (which of course most people here know you would have), that’s akin to looking for flour, but then adding egg, milk, sugar etc, baking it, then calling the cake you baked, ‘flour’. And you would feel justified in saying it’s flour, because you had a predetermined result (bias) based on reported symptoms before you started. This is clearly the case for SARS-COV2, and I’m certain it’s not the first time this has occurred.
I don’t think you are curious, I think you are trolling. Your analogy just does not carry, point blank. When you do experiments, you run controls omitting various things. A virus replicates in cells, there is nothing you or I can do about that, so when you study viruses trying to understand how it all work together, of course cells are involved in many of the experiments you will do. This is Monday morning quarterbacking, you seem to think you can hold the scientific community to some unattainable standard. How would YOU do the science? The questions you are asking are showing me you have no clue what is actually involve in the science here: “Or did you take an unadultered sample, put it under the electron microscope and actually isolate from that?” If you knew what was involved in what you are suggesting you would have to laugh at how preposterous what you wrote truly is. You are certain and it is beautiful, and it is religious but it is not science, there are no certainties in science, as a scientist you doubt everything and you are happy to put in question your thoughts about any topic. But of course it is much more confortable to be certain of something and it has its perks too, like belonging in a group of like-minded individuals, feeling superior because one “understands” the evil ways of this world and then getting a little upset when faced with reasoned arguments that would challenged any of your views. Remember the concept of groupthink? Challenge yourself, is it not what is going on here? I like to challenge that, I did against my government and that’s what I am doing here.
The standard method to identify a virus is to use filtration to eliminate larger particles so that any infectivity or toxicity remaining must be a virus.
Why has that not been done with SARSCOV2?
Sure, that’s one of many methods, there is also ultracentrifugation through gradients of various densities, chromatography, affinity capture, etc… I used filtration for purifying viruses sometimes, but it is not really the essential point, it’s a 19 century technique one among thousands of techniques used to study viruses.
did you say you caused disease in the animals?
https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/#comment-199212
Sin Hang Lee, MD, F.R.C.P.(C)
Milford Molecular Diagnostics Laboratory
2044 Bridgeport Avenue
Milford, CT 06460
USA
March 22, 2020
Dr. Margaret Harris
The World Health Organization’s coronavirus response team
[email protected]
Dr Eduardo Guerrero
WHO Regional Office for the Americas
[email protected]
Dr. Anthony S Fauci
[email protected]
Extremely sensitive, no false-positive tests needed for SARS-CoV-2
Dear Drs. Harris, Guerrero and Fauci:
It has been widely reported in the social media that the RT-qPCR test kits used to detect SARSCoV-
2 RNA in human specimens are generating many false positive results and are not sensitive
enough to detect some real positive cases, especially during convalescence.
RT-qPCR is known to generate false positive results when used to detect influenza A virus [1]
and MERS-CoV, [2] another Coronavirus.
Without a nested (two-round) PCR, a single round RT-PCR may miss real infections caused by
SARS-CoV [3] and by SARS-CoV-2 [4].
The major technical flaw of RT-qPCR for molecular diagnosis is the limitation of the length of
its DNA probe which is about 25 bases long or shorter. And hybridization is not an accurate
method to determine nucleotide sequences, the foundation of all nucleic acid-based diagnostics.
This letter recommends that the WHO coronavirus response team adopt or develop a nested RTqPCR
protocol to generate a cDNA PCR amplicon to be used as the template for bi-directional
sequencing. As demonstrated in this letter, nested RT-PCR is an extremely sensitive detection
method and DNA sequencing will guarantee no-false positive results if all positive reports are
accompanied by two-directional sequencing electropherograms, like an EKG for the diagnosis of
Left Bundle Branch Block in a cardiologist’s consultation.
Based on information retrieved from the GenBank databases and available in the public domain,
there is a unique 398-base segment in the SARS-CoV-2 nucleocapsid (N) gene which not only
has a 100% match with that in the Wuhan seafood market pneumonia virus, but also contains
four single-nucleotide mutations found in the viruses isolated from patients in the states of
2
California, Texas and Massachusetts of the U.S.A. This segment of the gene can be targeted for
accurate molecular diagnosis.
The nucleotide sequence of this 398-base gene segment is copied from the GenBank and reprinted
here with the 4 mutated bases typed in red color. Identification of these virus isolates
each with a single-base mutation in this segment may be useful in tracing the immediate source
of the pathogen among patients and carriers tested positive for SARS-CoV-2.
Severe acute respiratory syndrome coronavirus 2 SARS-CoV-2 RNA
Isolated from throat swab of patient in cruise ship, Japan, 02-10-2020
Sequence ID: LC528233.1
Query 1 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 28728 CAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAA 28787
Query 61 AGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 28788 AGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACG 28847
Query 121 TAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 28848 TAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAG 28907
Query 181 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 28908 AATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCA 28967
Query 241 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 28968 GCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAA 29027
Query 301 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 29028 ATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAA 29087
Query 361 TGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAA 398
||||||||||||||||||||||||||||||||||||||
Sbjct 29088 TGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAA 29125
NOTE: This 398-base sequence is identical to that of the Wuhan seafood market
pneumonia virus, isolated in December 2019, GenBank Sequence ID: NC_045512.2
SARS CoV-2 isolates in the USA may have following single-base mutations in this
segment at the positions typed in red (Sequences were retrieved from NCBI Databases).
29103 C>T Sputum of patient, TX, USA, 02-11-2020 Sequence ID: MT106054
28886 G>A Nasopharyngeal swab, CA, USA, 02-06-2020 Sequence ID: MT106052
28862 C>T Oropharyngeal swab, MA, USA, 01-29-2020 Sequence ID: MT039888
28792 A>T Nasopharyngeal swab, CA, USA, 01-23-2020 Sequence ID: MN994467
3
4
Please inform your affiliated laboratories that we are now in position to assist them to resolve
their questionable RT-qPCR test results with high Ct values (between 37 and 40) if they are able
to send us 10 μL of the residual RNA extract kept at -80°C in dry ice package. We will perform a
nested RT-PCR on each of received residual samples, and perform a bi-directional Sanger
sequencing on all positive cases and report the results back to the sender.
Contact person is: Sin Hang Lee, MD email [email protected]
Sincerely,
Sin Hang Lee, MD, F.R.C.P.(C)
References
1. Martí NB, Del pozo ES, Casals AA, Garrote JI, Masferrer NM. False-positive results obtained by following
a commonly used reverse transcription-PCR protocol for detection of influenza A virus. J Clin Microbiol.
2006;44(10):3845.
2. Pas SD, Patel P, Reusken C, et al. First international external quality assessment of molecular diagnostics
for Mers-CoV. J Clin Virol. 2015;69:81–85.
3. Jiang SS, Chen TC, Yang JY, et al. Sensitive and quantitative detection of severe acute respiratory
syndrome coronavirus infection by real-time nested polymerase chain reaction. Clin Infect Dis.
2004;38(2):293– 296.
4. Nao, N., et al. Detection of second case of 2019-nCoV infection in Japan. 2020.
https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf?sfvrsn=fbf75320_7
this is all well and good, but it still rests on faulty assumptions, and that being that the RNA obtains was from a virus. It clearly was not pulled from purified “virions” (virions never proven to even cause illness).
That is the fatal flaw. They assumed it was related to SARS COV 1 and used primers based on that.
But of course if you look at SARS COV 1, the same issues arise. They did not obtain the ‘genome’ from any purified particles at all.
This goes on and on, in an almost infinite regression.
Every virus paper is like this. Not just coronaviruses.
If they do not purify particles, THEN, separate the suspected virions from extracellular vesicles of the same size/buoyancy, etc, and THEN Prove that those “suspect” virions are the cause of a disease (done in a physiologic way…)..
Then they have no room to move further forward.
Only once they’ve done the above, can they then extract the RNA from those virions and say “this is likely the genome of SARS COV 2”. (that is still obviously inductive, as they assume that sequence can exist nowhere else in the world, which is quite the assumption…)
Hi, I’m really just trying to understand this whole isolation issue and I found your comment interesting. On the CDC website they say that the SARS-CoV-2 virus has been isolated and they link a study from June: https://www.cdc.gov/coronavirus/2019-ncov/lab/grows-virus-cell-culture.html
I looked at the methodology they used for isolation but I have no idea what they’re talking about because I’m not familiar with the tools used in this field. Do you know if we can reasonably say the virus has been isolated? Or is it still questionable?
Waow, impressive article about the danger of knowing quite a bit and transforming it into total non sense because one has a thesis and is letting that thesis completely dictate the interpretation of the data. Has PCR or RT-PCR limitations? Of course it does, like every single technique in science. Do we usually fulfil Koch’s postulates to identify the cause of a disease? No, because it most cases doing so is unethical, or there is no time, like in the middle of a pandemic… Where is the SARS-CoV-2 RNA coming from…? From the virus or its replication in cells, where else? Is the SARS-CoV-2 the cause of COVID-19? That’s the best working hypothesis out there, do you have a better one?
The point is that the best working hypothesis is junk. Never should we sink so low in terms of evidence or risk and the media are careful to avoid explaining this to the public. The lockdowns which rely on PCR data will produce ten times the fatalities compared to the virus scare and this has already begun. I’d love to hear how you square the problematic ethics of Koch’s Postulates (should be River’s Postulates working at a 99.98% survival rate) with introducing an untested vaccine from a software engineer whose last efforts in this game infected a population with a new strain of the disease it was claiming to prevent.
I am not sure I need to square anything, I am completely opposed to Bill Gates’ influence in the world of medicine and health, and I am highly suspicious of new vaccines given how toxic most of those already on the market are. You can call the hypothesis of SARS-CoV-2 causing COVID-19 junk, but that does not make it so, it is a completely reasonable hypothesis if you understand the science as someone who has spent his life doing it, including working on SARS-CoV. From my perspective, if it turns out COVID-19 is not due to SARS-CoV-2 I certainly will be shocked and come here to eat my word, but really, fat chance of this happening, it is a no-brainer at this point. Now the elites are jumping at the opportunity to try to get some of their wet dreams to pass as laws and the press is doing everything they can to confuse the issues, so you get a total mess. On top of it has become an election issue in the US and you get the raving mad media treatment of it. As a scientist, seeing so many scientists and medical doctors talk absolute non-sense about an important question is disappointing but not really a shock because I know most are careerists instead of genuine scientists/MDs.
Fair enough, but what are the ethical problems with conducting proof based on River’s Postulates? How is that test crossing any new ethical line? I’d say trial vaccine patients are in the same boat but mostly its the millions of chronically sick patients who are now denied healthcare because of a virus scare would suggest the lockdown ethics are operating at holocaust level. The PCR issue is only the detail on the scam and people are realising that none of the official narrative stands up to basic scrutiny. Start any sentence by saying “The survival rate is only 99.98%…”
Seems like the survival rate is between 99 and 99.5% in the world. Death is not the only burden. Seems also like there are a lot of people who had it mild enough that they did not need to be hospitalised, yet are dragging multiple symptoms preventing them from resuming their normal life for many weeks, turning for some in months and it is not clear when and if it will stop, they are not counted well because at first many doctors were dismissive, but there are large facebook groups devoted to them in a number of countries. Then you have all the hospitalised people who experience more or less severe sequelae, we have to find out how they will fare in the future but if SARS is a guide, a substantial number will have issues, such as reduced lung capacity and probably more with COVID-19 because it has more effects outside the lungs than SARS did (then of course SARS killed more, we are talking survivors). Let’s not talk about the patients who were intubated, they need minimal one year revalidation and most will never recover fully. Hard to know what to make of what is happening in the US with perverse incentives for hospitals and what not, but looking at Europe, we have about 1% dead, 4% intensive care, 14% hospitalised. That’s a very significant burden on society.
Large facebook groups? I suspect if investigated there are large facebook groups devoted to many different aspects of the human condition – for instance that women’s male partners have narcissistic personality disorder – but that doesn’t make it true. Covid-19 symptoms were reported by the NHS as a dry cough and a high temperature. They were remarkably faithful to this diagnosis, apart from adding loss of sense of smell/taste during the incubation period. The symptoms of appalling aches and pains, debility and fatigue lasting for weeks matches flu symptoms, which kills far more.
dr morse explains people do not die from colds and flus. they die from the treatments: https://youtu.be/s1GYK2Coc84
“Seems like the survival rate is between 99 and 99.5% in the world. Death is not the only burden.”……. “we have about 1% dead”
Nice dodges, though probably not quit ready for peer review.
As one of those who had “dragging multiple symptoms” and “reduced lung capacity” – I would rather not be conflated with dead people.
Have you heard of the connection between the prevotella bacteria and covid-19 symptoms? Which is what makes hydrochloroquine and z-pack effective in covid patients. I would suggest researching is as many of the supposed covid symptoms are actually symptoms of bacterial infection caused by prevotella.
I sure have. It seems highly unlikely to me but not impossible, certainly. You know nowadays they do these deep-sequencing of biological samples such as autopsy lungs, and one of the interesting question that has come up for more than a decade now is the existence of a microbiome in the lungs, that different parts of the lungs are colonised by different flora of microbes, and how it can be affected by disease, infectious or not, with some species protecting or exacerbating a given disease. So you can be sure there are researchers right now doing exactly that, and with deep-sequencing you pick up every genome present in the sample and in what amount, so you can bet they will find the kind of associations I just mentioned. So if there is any microorganism that contributes to COVID-19 spread besides SARS-CoV-2, such as prevotella, they will find it and they will know if they find it in 0, 1, 10, 90 or 100% of the COVID-19 cases they are looking at, and they should be looking at large number of cases for the study to be meaningful. I am looking forward to the results of those kind of studies.
Hello. It is much more unethical for the medical community to appear as if they *have* fulfilled Koch’s postulates, making statements and facing the public in deceptive confidence, crushing any rational questions or comments on process which also crushes public trust, guiding global policies that *also kill as many people in unintended ways* guided by haphazard biased science being held up as a religious Nehushtan while omitting important facts about how the results of the so called science are obtained. Thanks.
Koch’s postulates DO NOT APPLY to viruses. There is NO NEED to fulfill them. Yammering on about them is truly ignorant.
Why do they not apply?
1) they were developed for the study of bacterial disease around 1890; 2) which means they were devised prior to the discovery of viruses; 3) Koch himself discovered that all four do not even apply to all bacterial diseases.
Not that I’m convinced they did it but why would they even bother if they, as you say in all caps, do not apply?
Koch’s postulates fulfilled for SARS virus https://www.nature.com/articles/423240a
he doesn’t know his papers, obviously. many viral papers still claim they “fulfill Koch’s postulates” when they don’t. but it’s fair game, since they’re the ones bringing it up.
The other criteria for “viral proof” are simply circular.
The whole thing is a joke. I’ve never seen worse science, from a purely logical/methodology standpoint.
having fancy toys doesn’t make their conclusions valid. They must actually show “x causes y”, and they don’t even purify “x” on its own.
its not a joke. its fraud. lanka said the kochs postulates were themselves a fraud because they said similar symptoms rather than same.
I agree, it actually is fraud. But I’m baffled the virologists can’t “see” their own logical flaws. Then again, it’s easy to get focused on the minutiae and not take a step back.
The methodology is so poor.
It’s an historical fact that Koch’s postulates are general principles applied widely for pathogenic microorganisms, in general. If you don’t want to be held accountable to any one of those four postulates (much less ANY of them), then you should have an explanation worthy of cross-examination. Your authoritative dismissal is nothing more than a sign of intellectual insecurity.
bacteria do not cause disease. they are a consequence of poor health. you should look for a job collecting waste so you can learn what causes bacteria to turn up in the trash cans.
Strawman, Ad Hominem, Appeal to Emotion
https://www.psychologytoday.com/us/blog/thoughts-thinking/201708/18-common-logical-fallacies-and-persuasion-techniques
Nice try. Just admit you are clueless and move along.
My point was about ethics, open transparency, process and policy. You changed my point to suit your own needs [you want to argue the validity of Koch’s postulates altogether]. This is known as Strawman logical fallacy, misrepresenting someone else’s point then refuting what you yourself changed as their point. Ad Hominem then means attacking the person instead of engaging in real discourse about the valid point. If arguing using logical fallacies are your preferred method, then it is you who are showing a rather tiresome lack integrity. Best.
you should collect evidence on those putting you up to this. come out with it before they point the finger at you. you havent much time.
Some in the actual research field at issue appear to diagree with your dismissal of Koch’s postulates. One being, Fouchier, no less.
Nature article regarding the first SARS (2003): “Koch’s postulates fulfilled for SARS virus”
Published: 15 May 2003
Koch’s postulates fulfilled for SARS virus
Ron A. M. Fouchier, et al
Nature volume 423, page240(2003)
Koch’s Postulates were revised for viruses in 1973 under River’s Postulates. This would be the ideal test to prove that what PCR claims is SARS-CoV-2 is actually responsible for COVID19. This would silence any debate on the issue and there is an urgent need to fulfil them.
The postulates of Rivers (1937, actually) can be roughly applied and guess what? They are fulfilled by the current evidence. Use this article as a guide to your journey of discovery. https://www.microbiologyresearch.org/docserver/fulltext/jmm/52/6/JMM5206.447.pdf?expires=1593538098&id=id&accname=guest&checksum=7EBA58A04A78D9877C950BEF2ABC0083
Apart from the current evidence being entirely dependent on the junk infection data from PCR and governments changing how deaths are recorded to suit a fake pandemic, I don’t have any problems with it.
Guess what? Your article does not present the faintest evidence of SARS-Covid-2 even passing the far weaker (and statistically manipulated with great ease) postulates of Rivers.
actually, Rivers criteria are quite circular. I’m not sure how so many smart people don’t understand it.
Koch’s Postulates are quite logical.
The issue overall is very simple. If you’re going to say “a virus causes this disease”, you have to first identify what you think is the virus, and then somehow show that’s the cause of a certain disease. Associations don’t count, as anyone who understands good science can tell you. ( I realize many papers post conclusions as “fact” which are simply petri dish associations, but here we are).
The other huge elephant in the room is this. Cell cultures will always produce these particles they’re seeing. always. without fail. They do not attempt to separate these suspected “viruses” away from the other vesicles. (there are papers discussing how difficult this is, and they don’t even try in viral papers).
So, they never even get “x” on its own. and since they do not do that, they cannot say they obtained the RNA from any “virion” proved to cause a disease.
This logic is sound. all I’ve seen as defense are circular arguments or appeals to authority. It’s a joke.
Dr. J,
You are correct about viruses and Koch’s postulates. That is why Dr. Rivers developed Rivers postulates for viral particles which of course CoVID-19 has not been shown does not adhere to.
not true, as they still use Koch’s postulates in their papers and say they “fulfilled them” (When of course they do not). therefore it’s fair game.
This is ridiculous. You need to know your papers better.
also, Hill’s criteria and Rivers are both circular. They had to develop them because the logical rules of Koch were just too hard.
Until you can extract purified particles, away from all other particles we know will be in a cell culture (EV’s), and then prove those are the cause of a disease, you have nothing.
They did not pull the RNA from purified virions. I don’t care how you spin it, this is not good science. It’s actually quite a blunder.
Koch’s postulates Identify the Causative Agent of an Infectious Disease. ANY infectious disease.
Hello Harvesta, I have to wonder what you think they should do, they have to say what they think they understand, no? The Koch postulates are from a long time ago and the thinking on how to establish whether a particular microbe may be linked or not to a particular disease keeps on evolving from that time to today and will continue to do so. Science is really complicated, there is no easy way to convey complex information in a few easy sentences. Scientists disagree all the time and it is good to question everything, it is the essence of science. In medicine, though, you don’t have the time for lengthy debates when the patient is in front of you and you need to help them, especially so during a pandemic. When you don’t have the time to go prove everything because you must make a decision now, you base yourself on the preponderance of the evidence. We know coronaviruses, we have seen them before, they are very good at jumping species, it happened in the 19th century, it happened in the 20th and it already happened 3 times this century but unlucky the third one is really contagious (actually it is the first two who were unusually poorly contagious as respiratory viruses usually are very contagious). So yes, even though scientists disagree all the time, I don’t see much disagreement here because collectively the evidence is really good COVID-19 is due to SARS-CoV-2.
Hi Marc, I can certainly agree with some of your points here, such as limited time frames, valuing the patient lives over completely proving the science in the short term…What I would change is for all governments and scientists, and some *are doing this* to be honestly and clearly open that this is what they are exactly doing for sick patients, then make recommendations rather than orders or laws in relation to the unproven science, while continually allowing and encouraging rational discourse or attempts to disprove the results (as is customary) or valid questions about the science instead of censorship, shaming, and policing. Consider all new evidence. Testing is required now in many places. Some healthy nonsymptomatic people do not want to take this rt-pcr test or wear a mask they deem unproven scientifically because it is foolish to use a solution that does not necessarily empirically relate to the real problem and so may have unintended consequences or worsen the problem or may be an indicator of an untrustworthy hidden agenda. As you realize, the quick science is not just being used to save patients but drive government policy. So yes, help the sick with the information we have now, but let all medics, journalists, scientists in on the inner loop continue to argue and study the exact nature of problem prior to setting global policy for healthy individuals. Global policies for healthy individuals should be set by long-term proven policy in order to ensure trust and legitimacy of social expectations. Legitimate power is allowed and given by the people via transparency and trust in the honesty of the intention of power. If people are contesting the legitimacy of power, it usually indicates dissolution of trust. Trust is simply needed for effective mandates.
Dear Harvesta and Marc, as I am not a scientist and rely on sites like off-guardian to provide analysis and well informed commentary, my question is: what is the covid19 condition? From all that I see we are told (by WHO, government health agencies) about its symptoms, they are common to a variety of respiratory illnesses and influenza. What is unique in a covid19 symptom that is absent in other lung and respiratory tract infections, pneumonia and bronchial disorders?
It is a fact of respiratory viruses that you cannot generally identify the responsible virus just by the symptoms. There are many families of viruses capable of causing respiratory symptoms, and all of them induce flu-like symptoms, which also vary from individual to individual. If you do large scale studies you may find some weak differences in presentation between viruses, but they are useless to diagnose. You know which respiratory virus by trying to propagate, purify and amplify the virus in a cell culture, and identifying its genomic sequence when it is a new virus so that a much simpler test than cell culture can be used to detect the viral RNA (the infamous RT-PCR). And a given individual may have more than one virus in his lungs, may have two, three or (rarely) more. Now loss of taste and smell in a viral infection is not unheard of, but uncommon. With COVID-19, there seems to be 2/3rd to 3/4er of patients with that symptom. So even with a negative PCR test (there are of course false-negative, if only because the virus is not necessarily present at the spot where they brush), I would consider someone who looses his sense of smell/taste are very likely COVID and get a confirmatory lung scan.
What do you mean ‘confirmatory lung scan’? There are no specific lung signs for covid19, and the vast majority of people infected with this agent will have no symptoms or mild cold symptoms and no lung involvement at all. Just like the flu.
A lung scan is absurd unless you have severe symptoms of potential pneumonia, and all it will tell you is how clear or damaged your lungs are. It will NOT tell you what has caused the damage.
And loss of smell and taste is a side effect of the common cold!
Fact is there are findings on lung scan even in people without symptoms. Ground glass opacity as they like to call them, and yes, like flu-symptoms, not specific of any virus. [Please provide a citation for this – ed] Of course it will not tell you what has caused the damage. As I mentioned, not unprecedented for respiratory viruses, but usually rare instead of being seen in the majority of patients, like for COVID.
Some should consider stepping down from their high horse getting all uppity about proof this, proof that in the middle of a pandemic.
What are you doing to help?
That’s what I thought!
Yes, silly us getting all worked up about “proof this, proof that” when there’s a pandemic we need to deal with!! Are you actually, seriously trying to pass this reasoning off here??!
You have arrived about a 6 weeks too late to this party, pal. We have had every bot under the sun talk about ground glass opacities, passing themselves off as scientists, presenting flaky junk science and arguing from authority while saying nothing of any inherent value.
And are you a doctor or a virologist excuse me?!
Demonstrate some fact-based, evidence-based, science-based reasoning in your replies. Provide citations and STOP arguing from authority.
A2
Read everything I wrote on this site, I am clearly not interested in this kind of gutter debate so you can have that one with yourself if you wish. I stated my credentials a couple of times, I am using my real name instead of hiding behind a pseudonym, so you instead of conflating me with whatever bot you are talking about, do a little research so you can realise don’t have to be insulting. I have published about COVID mostly in French since I am dealing with the Belgian government but some of it has been translated in Europe and even in Asia. In the US, I know Paul Craig Roberts posted a translation of a number of my texts, and the later ones contain a number of links as tiny url to all the scientific literature I am citing in my analysis. So come down from your high horse, I understand it all makes you anxious, but life is complex. Not everyone you meet online is there to pull wool over your eyes.
You have made around 20 posts, all under this article, and in none of them have you refuted or addressed anything in the article.
Instead you say things like
What does this actually mean?
What high horse?!
Surely good science is all the more important during a ‘pandemic’? What reasoning do you employ to refute this?
Would you care to respond to or refute anything in the article, above? Much of it directly contradicts your position re. this virus.
Since you state you are a corona virus expert, I am frankly quite astounded and, I admit, not a little frustrated, by the unscientific focus of your responses so far.
A2.
“Surely good science is all the more important during a ‘pandemic’? What reasoning do you employ to refute this?”
Of course good science is very important, where did I dispute that? The article is long and sorry I don’t have the time to go point by point, but I did in my first post explain the gist of my objections. Then I am confronted by people denying the existence of the virus or of the disease itself. OK, fine.
Let me put it from a point of view you might understand. I have explained my views on false flags. I would think most of you would probably agree with me on this point, right? Say someone shows up on this board and the topic comes up in the discussion and the newcomer says absolutely not, this is a bullshit idea, the US has never engaged in any kind of false-flag. OK, I can talk about the topic for easily 24 hours straight, but you and I know that no amount of talking is going to convince that guy that false-flags are a historic fact, right?
So don’t you see it is exactly the same situation here between you and me? You guys are arm-chair scientists, you might be the smartest person alive for all I care, you don’t know science like someone who has done it 80 hours a week for 35 years, that’s all. It is not a position of authority, it is a position from experience and understanding. I tried to shine some light on reality here, because I am sorry to say on this particular issue of science, you are divorced from reality, even though all your grief with the government is perfectly warranted.
You may have been trying to shine some light, Marc, but I’m afraid you have not succeeded. Instead of explaining your position using data and analysis you have side stepped direct questions, responded with vague generalities laced with ad nom and with the demand that we should simply accept you are too clever to explain yourself because you are a scientist and we are not.
That last is the very definition of an argument from authority, and is unworthy of someone alleging to be a published virologist
Very sad to see.
Sure, cry me a river. I would come with papers and what not but would you go waste your time trying to explain the earth is a spheroid to a flat-earther? It is what it is. I was not prepared for that level of denial. You are so far out with no virus and no disease, sorry you cannot see that. I would be blind not to see it is a waste of time as your mind does not seem to be open to these two concept. Please don’t be sad, it is so not worth it. Cheers.
There is a big difference between claiming the virus doesn’t exist and pointing out there is no proof of its existence because it has never been properly isolated.
The first is an opinion, the second merely a statement of fact.
Are you claiming the virus has been isolated in the traditional way by filtration to rule out the RNA belonging to some non-viral entity?
The flat earth comparison is a further attempt to discredit without resorting to data, but to answer your question – if I were to debate a flat-earther I would do so by marshalling all the data that proved the earth to be a globe. I would not avoid their direct questions, insult them circuitously and end by demanding they just take my word for it because I was cleverer than they were.
You argue like a person who knows he can’t win a factual debate and so opts for evasion. I am truly stunned to see that in someone of your background.
Ok, it is good to come to a simple question, one at a time.
OK, let’s think through what a virologist would do, he has a sample from a patient and he suspects a virus is present in the sample. He spins the sample down, maybe at 15,000 g, which pellets cellular material and other debris. In the supernatant are soluble material, RNA, DNA, proteins, lipids and viruses (bacteria are pelleted too). He treats the sample with nucleases which will eat all the RNA and DNA that is not protected by a viral capsid/enveloppe. Now he pellets the virus, spinning it down at 100,000 g and doing so getting rid of the nucleic acid debris that stay in the supernatant. He washes that pellet a few times, and he know has purified virus. He can put some on a suitable cell culture and now amplify the virus in the cells. He can also extract the nucleic acid from the virus and sequence it. Or he can put it on a little grid to take a picture with an electron microscope. There you have it, a pure virus as the sole source of the genetic material you have sequenced and you did deep-sequencing so you know you have not missed a single nucleotide of sequence. That’s how it’s done in most labs, and many variations are possible in terms of techniques used but the bottom line is the same, you have purified a virus and determined its sequence.
See it was not hard, find me the flaw in the approach just outlined.
Please kindly explain to me why on earth you need that filtration non sense as that one ultimate proof you guys have been waiting for which is so 19th century? Where would you want the RNA to come from besides the virus? Answer this, it is a key question! See I made a number of points you have never acknowledged but if you want to play scientist, what is your theory as to where the virus sequence is coming from? The cell in which it is replicated as some of the crazy ideas I have seen here without the virus being there first? The genome of these cells are completely sequenced, so it is not coming from the cell…
What is your theory? In science it is always about competition between theories. You think there is a flaw in the theory that SARS-CoV-2 is the cause of COVID19, fine, it is your right, but what is the flaw (you say no filtration, but what it the flaw in the method outlined above, which does the same separation as filtration)?
And what is your competing theory for the origin of the viral sequence?
so basically you are trained in pseudoscience and disinfo tactics.
Rachel, really, that’s all you can say? Trained in disinfo tactics? What about able to recognise them? Pseudoscience, I just described to you how virologists go about a new virus, what exactly is pseudo about it? You are good at throwing words and you think you have responded to my post?
such symptoms are detox symptoms. they can be triggered by many things for example they are listed as effects on pharma drugs.
When was the last time you saw detox symptoms spread exponentially across countries, Rachel? You think because you can come up with an alternative explanation for one aspect that your view is valid? What’s responsible for the spread of the detox symptoms, Rachel? Why would healthcare workers without mask get detox symptoms and those with mask would not? I will be waiting for your answer.
I’m not a scientist, i work with computers, software, logic is my day, true/false (some background data).
I started smoking cigarettes (didn’t smoke for 6 year), i’ve all the respiratory symptoms, and all of them induce flu-like symptoms, and loss of my sense of smell/taste.
So cigarettes or covid?
for me after reading the article and all the comments so far, cigarettes.
confirmatory lung scan?
If i use program (software) of medical / political / economical / monetary / media ?
I have no doubt, no fear, no query, no more data so say covid
P.S.
It’s my real name also.
PORTUGAL
humans are intelligent, not software (programs)
If you were to ask the question to a physician, cigarettes or covid?, he would run some tests to have a basis to answer your question. In medicine it is exceptional that you base your diagnosis on a single factor, there are usually dozens, and if that is not enough to discriminate between several possibilities, they run more tests. In the emergency situation, with RT-PCR not being 100%, you go with the full clinical presentation, all the symptoms and all the scans and X-ray you have done. CT-scans turned out to be particularly useful, yes as a screening tool (except for those patients for whom it would be contraindicated).
I’m dealing with Mr. Gates software since the beginning.
https://www.bibliotecapleyades.net/sociopolitica2/sociopol_win-micro-gates65.htm
https://www.bibliotecapleyades.net/ciencia3/ciencia_virus127.htm
every software engineer knows that any algorithm (program) you produce your finger print is in there and your colleagues recognize it.
I recognize that Mr. Gates is very patient, and this is just a beta version.
It is unethical to presume a disease exists because doing so will allow for dangerous manipulation by vested interests, which is exactly what has happened in the case of covid.
There was no pandemic. It was again presumed. The pnuemonia cases in Wuhan could have been from a big surge in toxic air pollution that was anyway at elevated levels for much of the last 2-3 years.
This would have been probed by Chinese government had it not had a vested interest in hiding the fact from its people.
Proof of a disease and proof of a virus is a must before the declaration of a pandemic. Without a proof, there is no pandemic. And, it is not just unethical but criminal to declare one without proof.
It is interesting to read the comments on this site. The disease does not exist? It is all fake, in all these countries around the world, some of which have very antagonistic relations with each others yet they all agree on pulling this hoax? The disease is faked, the people dying is faked? Impressive coordination. The virus does not exist? Even though any country that decide to sequence the virus finds the same sequence, with accumulation of mutations as the virus spread from places to places? Really? Neither the disease nor the virus is presumed, they are observed and documented. Science is looking at evidence and coming with an interpretation, not starting from an interpretation and trying to find facts that support a pet theory.
The sequence is hardly a proof of the supposed disease called ‘covid’. Much more rigour needs to be shown in any major claim such as a pandemic-causing disease. It is not a trivial matter.
And, of course, it can be a globally-coordinated manipulation. When the stakes are high for the global cartels operating on the sly they can go to any extent.
False flags have happened in the last 2-3 decades and governments worldwide have colluded in some way or the other, directly or indirectly. Sept 11 events, Iraq’s invasion are two major examples.
Several articles here on OffG itself since mid-March has covered almost every angle. One good one is this –> https://off-guardian.org/2020/05/05/virus-of-mass-destruction/.
I remember explaining to incredulous US friends (was living in the states at the time) in late september 2001 that it was an obvious false flag, I need no education on the topic I see them from a mile away, like I saw from a mile away this pandemic coming having worked extensively with SARS-CoV-1 and seeing that the CoV-2 had all the properties that were missing from CoV-1 to make that one capable of initiating a pandemic. Seeing too that my current government (Belgium) was not taking any of the common sense measures you need to take when facing a pandemic, I did my best to alert the country. From my perspective, governments in the west are letting the pandemic happen on purpose by pretending to be bumbling idiots who do not know how to handle a pandemic and who are all curiously devoid of the strategic reserves of needed material (PPE, etc.) when not so long ago most western countries had such reserves. They might have had their plan ready for the next pandemic and are just rolling it out. They could have stopped it, they still could stop it, but they look like they are not really interested in doing so. Count your blessings if the strains circulating in the US are not as lethal as elsewhere, but it is now booming in the south and in the west. People confuse politics and public health.
covid19 is the definition of the disease caused by the alleged virus. you have then inverted that to say the hypothesis is likely because the result of the hypothesis the disease exists. completely insane verbal diahrea. there is no covid19. as dr morse explains there is no diseases just sets of symptoms defined as such by lunatic allopaths.
Oh boy. You are right about the completely insane verbal diarrhoea. You start with the infectious disease and then you find the microbe, in this case a virus. How hard is that to understand? Honestly, what does it mean to you there is no COVID-19? You are not a doctor I suppose, but when you have a sick individual in front of you that you need to help, in English the set of symptoms that are usually associated and presented together by patients define a disease, and for an infectious disease you also like to identify the microbe. We all know the world is very corrupt with elites trying to ram their agenda down our throat, but that does not mean the disease does not exist and the virus does not exist, it does not follow and at this point it is rather childish to insist it is alleged without any evidence.
no you dont presume there is an infectious disease and then presume a piece of cellular debris is the cause. to do so certainly is of no help to the doctors in helping patients infact terrifying them and denying them any knowledge to be able to help.
Right Rachel, but that’s the part it is hard to have a conversation with you. Who is presuming an infectious disease? At this stage there is no presumption of an infectious disease, there is an infectious disease propagating on earth that maybe you dispute the severity of it or how contagious it really is or how it transmits or how insane the official response is, but there is a disease circulating, I am sorry to say. And it is OK if you don’t believe there is a new disease, realise I am fine with that.
Where is the evidence showing that there is a virus spreading around the world? You mean to tell me that the samples taken from those in Wuhan and were not purified, meaning the sequencing done for this so called new disease could contain any number of other genetic material from the body, then send out pcr tests which test positive on papayas, goats, sheep and even tested positive on swabs that had no samples on them… you want to tell us there is a virus spreading round the world? How stupid do you have to be? How about all the people who tested positive having 1, 2, 3, 4 or more preexisting health issues and getting covid placed on their death certificates as cause. Not mention the countless other deaths blamed on covid because they “suspected” it’s presence. Oh and the number of deaths caused by other health issues going down at the same rate as covid going up as compare to previous years.
You’re a mainstream scientist taught in the mainstream curriculum. You’ll have believed blindly that what you were taught was true. Many “scientists” don’t question anything a out what they were taught which basically means it’s a religion and operating on faith only. You work in a lab and your field of vision (metaphorically) is so narrow. Mainstream scientism looks at the body like some mechanical machine and that nature is dangerous place that’s out to cause harm and kill us all. It presumes that we are inherently unhealthy and incapable of health without medical intervention and yet all the so called “advances” of modern science and all we see is people getting sicker and sicker each year. All the toxins brought about by the industrial revolution from industrial waste, pollution, pesticides, synthetic/gmo/processed foods/minerals/vitamins, vaccines, pharmaceuticals,polluted drinking water, petrochemicals in almost all body/hair products, emf and radiation and the list goes on. All this toxicity in the world and the first thing scientists look for is an invisible harmless particle of rna/dna wrapped in a protein, which isn’t alive and harmless without a cell and that is easily broken down by the digestive tract.
Pompeii reported that this is a LIVE EXERCISE! In other words a fake pandemic!!
It is right, since you pertain to being a credentialed person of science, to subject your opinion to scrutiny, or else everyone and anyone could turn up here arguing from authority.
Is this your real name? Someone bearing your name appears to be writing articles online. Is this you? What are your credentials?
In answer to your post above. You don’t actually refute anything this article says.
Does this mean good science isn’t necessary then? Also, I find the reasoning that there’s no time to reliably identify the cause of a pandemic in the middle of a pandemic rather unreal, rather SURreal, and completely circular.
You use the term ‘working hypothesis’ but surely we are way beyond that stage, given the world’s sole focus on nCov2 as the causative agent in this ‘pandemic’ and the billions being invested in social control mechanisms to counter it?
What you colloquially call a ‘working hypothesis’ I call an insane hodge podge of assumptions. Surely a hypothesis has to explain all the observable facts and be arrived at through some basic scientific process?
Please, can we avoid arguing from authority. If you are going to allude to your credentials please make them well known. Best of all, since we are here to spread knowledge rather than simply gainsay, please post citations and argue points logically and clearly. Thank you, A2
Yes it is my real name, unlike most of you. You can go to pubmed to see what I published in science, my middle initial is G. I am not talking from authority, I am willing to share some knowledge but I will not submit to non sense. You can call what I say an insane hodge podge of whatever, I fortunately have better things to do than prove to you anything since clearly your mind is already set on these issues. You know you seem to expect from authorities to have all the perfect answers to all your questions. Guess what? They don’t, they never will. You need to make your own opinions and it is hard because you don’t know what to trust or not. Even for me who has the necessary education to read and understand all these papers, there is so much deception in the world it is hard to know what is going on. So I don’t mind answering questions for people who are trying to understand the situation and I have been doing that for non scientists since the beginning of this crisis, but I have zero interest debating people who are so divorced from reality that they don’t “believe” in viruses in general or this disease in particular and make me answer for the crimes of the elites. Some of you guys here are incredibly aggressive in tone when it is completely unwarranted. Chill.
I put it to you that you are not who you claim to be. Many scientists contribute beneath our articles. You claim to have better things to do than defend your reasoning, yet you clearly have plenty of time to post vague, information-free replies here. Why do you opt to patholgize my motives for asking questions while dodging actually answering any of them?
And excuse me, are you a virologist, a doctor or a psychologist?? You demonstrate very little understanding of field-based science or medicine. Or are clever people in ‘science land’ able to lay down the law across all disciplines according to you?
And YES you are arguing from authority, although you don’t seem to know what this means.
Your scientific lexicon, your medical understanding, your respect for logical debate is not evident. Instead you avoid answers to direct questions with emotionally manipulative statements.
Please stop arguing from authority. Stick to fact-based, logic-based, science-based arguments with citation where required.
A2
Well, I am who I say I am, here is my response to admin1 for your much requested scientific explanation, please tell me part which part does not make sense to you. Thank you!
https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/#comment-199862
“I fortunately have better things to do”
You do not seem to be doing them. LOL
I answered my own question btw a purified virus was executed for SARS, which means this article is absolutely right in highlighting the failure to do this for COVID 19.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7129641/
Only not really… https://en.m.wikipedia.org/wiki/Blind_men_and_an_elephant
Thats a very appropriate parable, in this we are all blind men feeling our way around hoping for some kind of objective truth. I make no claim to have any special knowledge. However if I were one of the blind men, I would like to think I would ask some more searching questions.
So what are you saying that SARS was not purified, or that the article is wrong in saying that COVID has not been purified?
Hi Rorsharch
Sorry I hadn’t made that clear.
Looking at the paper I see that isolation seems to mean something other than what I would call it.
SARS-CoV cDNA was derived from infected cell RNA, provided by the CDC, Atlanta. It’s fused with small ubiquitin-related modifier, antibiotics, and e-coli.
Seems more like George’s Marvellous Medicine to me.
This article does not mean at all what you seem to think, it is about producing some protein from SARS-CoV in bacteria.
Ok thanks for the clarifications, being honest I’m way out of my depth here.
So if it hasn’t been acheived for SARS or MERS, has the purification of a virus, as it is described in this article, ever been acheived?
As a non scientific person its difficult to assess what significance to attach to the lack of execution of purification.
they have no therapy to offer. the complexity merely to put themselves on a pedestal. you can easily understand detox by going on a fruit diet for a week and seeing the junk coming out. the junk they want to poison and kill you and blame on “diseases”.
Right, they have no therapy to help! Not true to start with, the patients are being treated but not everyone who is being treated is sufficiently helped by the treatment. Of course there is a big effort to find better treatment, and of course big pharma wants to eliminate the cheap competition, so they denigrate the herbs from Madagascar or the hydroxychloroquine by dishonest manipulations. Go ahead and detox, a healthy body is in a better position to fight off microbes than an unhealthy one, duh.
dr morse says he has never seen anyone die of pneumonia. a few days on fruit clears these symptoms right up. none of the perps of this crime have done anything to calm people down or raise their vitamin d levels or hydrate them. they have simply been attempting to cause deaths spreading fear, takeaways and staying indoors. they have no business in health only in terrorism destroying social closeness and love.
I don’t know Dr. Morse but who cares what he has never seen? Thousands of doctors have had patients die from COVID-19 with the proximal causes include pneumonia or various organ failures when not multi organ failure since unfortunately this virus attacks the vascular system which allows it to access any organ, including the heart, the brain and the kidneys. Reading you I can tell you will dismiss them all as liars and murderers, please suit yourself. Don’t confuse the elites trying to destroy us and divide us with the people on the front line trying to help dying people. Grow up.
nope. this paper already assumes SARS has been isolated/purified and the RNA came from purified particles. Which is false. You must always go to the source papers, where they claim “discovery”. it’s a big rabbit trail. just follow the references. Have fun. Then do it for other viruses. You may be amazed. 😉
1)
Dr. Andrew Kaufman:
Dr Andrew Kaufman, A Breakdown on Current Testing Procedures
2)
Dr Andrew Kaufman exposing the ‘Covid-19’ magic trick – the sleight of hand that transformed society
About Kochs Postulate
Apr 21, 2020
3)
Dr Kaufman Asks is it Virus or is it Exosomes?
Apr 2, 2020
4)
DR. ANDREW KAUFMANUNMASKING THE LIES AROUND COVID-19: FACTS VS FICTION OF THE CORONAVIRUS PANDEMIC
29.04.2020
https://londonreal.tv/unmasking-the-lies-around-covid-19-facts-vs-fiction-of-the-coronavirus-pandemic/
5)
Dr. ANDREW KAUFMAN ~ “A DOCTOR SPEAKS OUT: Secrets, Lies, Fake News & Coronavirus” [Age Of Truth TV]
28.04.2020
Kochs Postulates were devised prior to the discovery of viruses and hence do not apply. Further, Koch himself even abandoned the first postulate after discovering it was not universally true. Lots of half truths and misdirection with these clown shows.
Op-Ed: Does the 2019 Coronavirus Exist? (About The Gold Standard and Kochs Postulates)
https://www.greenmedinfo.com/blog/does-2019-coronavirus-exist?utm_campaign=Daily%20Newsletter%3A%20Coronavirus%20-%20Cowdan%20-%20Fixed%20%28Ji2mSU%29&utm_medium=email&utm_source=Daily%20Newsletter&_ke=eyJrbF9lbWFpbCI6ICJpbmZvQGdyZWVubWVkaW5mby5jb20iLCAia2xfY29tcGFueV9pZCI6ICJLMnZYQXkifQ%3D%3D
Was the COVID-19 Test Meant to Detect a Virus? (about the PCR test method)
Posted on: Wednesday, April 15th 2020 at 2:15 pm
Written By: Celia Farber
https://www.greenmedinfo.com/blog/was-covid-19-test-meant-detect-virus?utm_campaign=Daily%20Newsletter%3A%20Was%20the%20COVID-19%20Test%20Meant%20to%20Detect%20a%20Virus%3F%20%28Xb2GrQ%29&utm_medium=email&utm_source=Daily%20Newsletter&_ke=eyJrbF9lbWFpbCI6ICJqYW5kdXBvbnRAaG90bWFpbC5jb20iLCAia2xfY29tcGFueV9pZCI6ICJLMnZYQXkifQ%3D%3D
No
Ive spent a lot of time reading this article and reading around it on the internet, its a complicated subject and I am far from qualified in this area. with that caveat in mind for me the claim in this article that seems irrefutable is that PCR testing is a blunt weapon at best, and clearly not intended as a diagnostic tool.
However the articles Robbobobin posted have taken apart the claim that Koch’s postulates are required to be followed to prove causation in virology. There are numerous examples whereby the conditions of the 4 postualtes could not be met for diseases the existence of which none of us would dispute.
The question to which I cannot find an answer is; Has an isolated ( as in purified) virus been executed for other viruses such as ‘MERS’ or ‘SARS’. It seems to me that if this Gold Standard was not produced for these, then it rather takes away the central argument of this article, because surely no-one would doubt the existence of viruses with IFRs of 10 and 30%? And it would mean that the methodology of isloation as described in the Chinese and Korean studies is in fact sound and legimate practise for establishing the existece of a virus?
However interesting all this is, it does not of course change the fact that the global response to the disease is a counter productive over reaction, for whatever reason
In referencing a sequence* of papers concerned with exploring the ongoing temporal relevance of Koch’s original postulates given a developing understanding of the “facts on the ground” I’m afraid I took the rather restricted line of addressing only the contrary persistence of antidiluvean Kochean fundamentalism. A major problem is that those perceived facts are increasingly at odds with the currently overriding biological paradigm of Neo-Darwinism. Andrew Kauffman has proposed a sort of reconciliation with his idea of a confusion between viruses and exosomes but you may care to look at the ideas of Luis Villareal, particularly his concept of “gangen” (derived from his earlier concept of “cohorts”) for a more productive line of enquiry on a broader front (perhaps even extending, on sufficient reflection and observation, to an enlightening of Karl Friston’s recently proposed “dark matter”). Unfortunately I don’t have time right now to reference a suitably succint but adequate explanation of Villareal’s ideas, but Google or direct reference to his long-term work at Stanford should uncover several.
* unfortunately rendered out of order due to either a misapprehension on my part or the recent change in this site’s discussion software: intended to be read in reverse order.
‘Enlightening’? NOT. Very bad choice of word. Substitute ‘illuminating’.
Great article. Nice work, thank you. I’m now a Patron. I’ve been listening and reading David Crowe’s work regularly and have learned so much. I highly recommend it for those interesting in thinking.
1. https://davidcrowe.ca//DavidCroweWritings.php?version=flafiav13.
2. https://theinfectiousmyth.com/
We got this cool diagnostic tool a few months ago – https://youtu.be/zBdrVtQqbRI – and today we got this car into the shop for repair – – but the problem is, we can’t find nowhere to plug our diagnostics in. It sure ain’t under the dashboard. Can anyone help us find the location of the car’s diagnostic hole? Thanks.
P.S. We came across this on the interweb:
Is a causal connection some sort of adaptor? The car’s not new. Should we be looking for an older sort of connection hole?
…Continues:
Or you might try to persuade the owner to trade up to a newer model – https://www.virology.ws/virology-101/ – unless s/he’s a total stick-in-the-mud (the arnswer don’t always loi in the soil).
…Continues:
Racaniello: https://www.virology.ws/2010/01/22/kochs-postulates-in-the-21st-century/ (but mind you don’t step in the usual BTL crap)
Fredericks & Relman: https://pubmed.ncbi.nlm.nih.gov/8665474/
Continued…
You might try a quick run through
Evans: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2595276/pdf/yjbm00
Rivers: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC545348/
Continued…
Thanks for the articles I think that is a really good point about Kochs postulates. Surely though the analogy you have used is a poor one. If the car pictured had an unknown problem, someone suggests its caused by say a chemical additive in modern fuel…it would be incredibly easy to run a diagnostic check ( ie visual and mechanical)on the engine of the car. Unlike with Covid where what is questioned in this article is existential.
A better analogy if you must use motor vehicles, would be that you arrive at a venue but you have been asleep and have no recolection of the journey, someone suggests that in fact you have been taken by way of a brand new vehicle that you didn’t know existed. You feel battered an bruised like you usually do in your old jalopy, you check for tyre tracks but they are faded, you speak to people but their recollections are vague. Somone tells you that they can analyse your clothing for traces…but as you have no empirical data regarding the new car the test is based on a serious of calculated assumptions.
And that my friend is the most stretched metaphor that you are ever likely to read.
No, I mustn’t have, I just did at the time and, having Googled 1890s automobile images my one-track OCD overtook intelligent discrimination. “You win some, you lose some.”
Lol
No ECU so check fuel, air and spark/compression.
Better yet think about how rubbish fuel injection, ECUs and diagnostics actually are.
here’s another
Sharon
@sharonboonie
Had a text this morning to say my Covid test was negative.
I have never had a covid test. It stated the date the test was done. I didn’t leave my house that day!!
I can imagine that it was counted as a test completed by the idiots in charge.
“I didn’t leave my house that day”
Possibly not, but you may have left your house several days earlier when the test was actually done,.
Has any of the genetic material sequenced been FULLY sequenced so that its complete genome is known?
Yes
Thanks. Will you please direct me to at least one scientific paper where the complete genome sequence was performed?
Tony have you formulated an opinion on this? Yesterday someone sent me one of the several studies appearing online claiming that it proves it isolated the virus, but I can’t understand anything of course, and the article here does not provide many clues as to how can one say if a study has achieved the goal of purification/ identification of the genome. If you have any experience you want to share…
Please send me the article at [email protected].
I just sent it
I received it. Thank you. I have sent it to Dr. Andrew Kaufman to analyze to see what they claim is true. If I receive a response, I will let you know.
Can you tell me what the paper’s called please so I can look it up?
https://mra.asm.org/content/9/11/e00169-20?fbclid=IwAR1sYDaf9-xeAY7nq3834Fm6SReyctJQyCean5pqaJ2fNUpudm3Ari5przk
Cheers Tony
OG – you can easily remove the image from my post at 1.35 – wasn’t aware it was so big – it s unnecessary and i cannot edit it – the post is useful as, yet again, it challenges the nature of testing – ta :0)
it appears Fatty Handycocky is making an announcement in parliament later about Leicester and the so called shady increase in positive tests – let’s hope the mayor tells him to fuck off!
OFFG, please also consider getting an article written on the legal immunity provided to medics,government agencies, hospitals, pharma companies, test kit manufacturers etc in Feb-Mar when pandemic laws were rushed through without debate.
I believe that if this legal immunity is removed, and the confidence with which they bluff us will be shaken and weakened.
I didn’t phrase the last line correctly. It should read: I believe that if this legal immunity is removed then the confidence with which they bluff will be shaken up and considerably weakened.
there is an emrgency law called soald based on the duty of care. all publications must be prefaced with a warning if the contain any sign of a lock down. call me crazy but its right there in stuck with u; one strike n u r out.
it was like a commet going over the top. the future generations mere very pleased with it. the dark forces were furious. i was in sheer terror but recovering now. the warning is the lock that was down. so soal is signs of a lockdown and soald is signs of a lock down. soal is a murky pond. simple.
StopTheCensorship #KBF
@StopTCensorship
Replying to @garethicke
How about this positive test that someone received after they booked the appointment, but DIDN’T turn up on purpose! How many more people has this happened to. https://abs-0.twimg.com/emoji/v2/svg/1f914.svg
https://twitter.com/StopTCensorship/status/1277536570451648513
I wonder if they’ll be publishing an article next month as to why the lunar landings were fake? That should really excite the newly arrived readers here from David Ike’s site.
I suspect you are here for the purpose of trolling.
No, I’ve been here for several years and support this site financially.
Fixed that for you. You’re welcome.
are you one of those conspiracy theorists arguing nature is hunting us down with a rabid virion hiding in your neighbours mouth? read medical woo much?
Currently UP 0, DOWN -13. It seems your money doesn’t trickle down to the BTLers.
Bo, thanks for demonstrating how to employ psychological manipulation against reason: it’s always helpful to understand the weapons proxy fighters for oligarchy wield and how they work.
Your tactic is an oldie but goodie: the “You can’t refute a sneer” comeback. You’ve sneered at the authors; how does one refute, not an argument, but a sneer?
The Simpsons writers of old exposed your move as that of a sad hack and fraud with the words: “Your honour, I’m so confident of the guilt of Marge Simpson that I’m going to waste the jury’s time rating the superhunks.” Just substitute Demeter and Engelbrecht for Marge and lunar moon landings for the superhunks and we have your updating of the same fallacy.
So thanks for coming out. You’ll forgive any here who decline to play the useful idiot/ Lionel Hutz role and remark, “Ooooh, he’s gonna win!”
That day is over.
“Bo, thanks for demonstrating how to employ psychological manipulation against reason”
😂
I don’t know where to start with this one. Allow me to give it a try:
– I’m completely aware of the false narratives the MSM are generally spinning on behalf of certain actors behind the scenes
– I’m completely aware of false flag events and who is behind many of them, including 911
– I’m completely aware of the pervasive and damaging role of Big Pharma, WHO, Gates, other self interests in creating problems and pushing their solutions for their profit, and totalitarian control.
However, not EVERYTHING is a conspiracy, not everything is fake news, not everything is done for the profit of the 0.1%. There ARE natural events, illnesses, situations which occur either by chance of nature, or design of nature…or more probably, the neglect or ignorance of our species.
You and yours seem unable to grasp that reality of nature, or our human fallibility to feck things up because we think we are so smart and exceptional.
Into this fallible void, of such realisation which you seek to rationalise, you decide to pour in theories to try and explain uncontrollable or inevitable events which highlight our mortal shortcomings.
It’s OK to do this. It is a psychological coping mechanism. You do it. I do it. The difference might be that…
…after witnessing our human bullshitting / bollocks, our arrogance, our destruction upon ourselves and our habitat for nearly six decades, I can see that we are fallible.
…I can see that we are very often so mismanaged by our “leaders” and that it’s more likely that they are utterly incompetent than them being hyper intelligent and hyper capable.
…I’ve concluded that the results of such incompetence is not by some incredible ability of theirs to be so intelligent and capable of organising themselves to deceive the remaining 99.9% of humans on this planet.
It’s probably “whoosh” right over your head, but I always live in hope that human intellect can rise above the propaganda and conditioning.
It it were true that you “live in hope that the human intellect can rise above the propaganda and conditioning” you would have engaged the arguments of authors’ Engelbrecht and Demeter. Instead you left untouched their substance in favour of sneering at them.
True to form, your response to me does the same.
The solution is simple, Bo: think with your intellect instead of your will.
In my earlier posts I stated my position clearly. It’s your choice to misrepresent what I wrote.
Good luck with that tactic with others, but it doesn’t wash with me. Now feck off and do mischief elsewhere Brigade 77 operative, I can sniff you a mile away.
Will you have it so, Bo?
Who can argue with your will anymore than your sneer?
Appropriate name: https://www.biodynamic.org.uk/
It’s always hilarious to see comments like this from Bo Lux because comments like this do NOT address or even attempt to argue against a single argument or fact put forward in the article. Which means the writers of the article have won the argument in the easiest way possible. Thanks Bo Lox. You’re a “genius”.
More of a genius than you, GCHQ Persona #189
Who is this David Ike of whom you speak, child?
No, actually, don’t bother answering. You’ve already embarrassed yourself. Perhaps you should just toddle off, quit while you’re behind, etc…
David Ike, the very intelligent and insightful man who allegedly had a nervous breakdown and allegedly ended up as a delusional story teller of lizards and royal families.
Lockdown getting to ya, Loxy? ;o)
No, I’m thoroughly enjoying living in a country outside of the Anglo-Saxon propaganda machine, where lockdown was lifted a while ago and life is pretty good.
Hmm. Life’s good, you claim. But you still can’t shake off your neediness, can you, Loxy?
Good luck! ;o)
Your comment has nothing to do with a very important article, whether you support this website or not. I don’t believe the article mentioned Mr icke once. You ought to take matters a little more seriously.
You would be better prefacing your user name with the word UTTER.
I disagree, not “utter“, rather “complete”.
Semantics really.
The main point is that normally intelligent people have succumbed so easily to such delusional nonsense.
I’m no fan of David Icke but as lockdown happened I couldn’t help noticing he had been right about rather a lot. We all remember about the lizards but he has been warning for years about increased govt control and mass surveillance. Was he wrong about that? As to slurring a very reasonable article with the old conspiracy style trope rather than arguing on the actual content, if you’ve got a point to make about any fallacy within the article then make it, otherwise don’t waste people’s time.
I agree that he was insightful, to a point. I’ve enjoyed a few of his articles over the years. However, his delusional nonsense about reptiles unfortunately damages his reputation and reliability.
Perhaps watch the interview with William Tompkins regarding reptiles…https://www.youtube.com/watch?v=-3HB7QoX51o
First time I’ve posted on here. I tend to agree with you about David Icke. Read a couple of his books but thought his presentations were over the top and I never warmed to him personally. Now I’m thinking I need to apologise, and even to Alex Jones for heaven’s sake.. And now this Leicester bollocks tonight. These aren’t cases, these are positive tests, probably with no symptoms. So yeah, conflate the gist of this article with what’s happened in Leicester and what do you get? Drum roll: a further experiment in social control.
Brilliant article! Lots of this was already brought to light by Andrew Kaufman md.
So in a sentence the article can be summed up:-‘The testing does not work because the virus does not exist’. Who’d have thought it? Anyone with a functioning and enquiring brain probably.
Tell that to the Chinese.
Southern Beijing is now in lockdown due to a surge in COVID cases following opening up a few weeks ago.
Wuhan, a city of 11 million was in total lockdown earlier this year.
Do you think the Chinese are doing this for a laugh? Do you think the Chinese are part of their enemy’s conspiracy?
You do know that they have had a mere dozen or so cases, ie people diagnosed as having the virus?
You seem incapable of answering why would China close down half of Beijing, and all of Wuhan, if this virus wasn’t serious.
How could I appear to be incapable of answering a question I have not been asked?
Bo asked you at 9:17 in the last sentence of his post; your response (we know from the indentation), not only not addressing his question but ignoring it, was posted at 9:40. He picked you up on the omission at 11:55; you denied he had ever asked it at 12:10.
Excelling yourself today, Steve. Broken scroll up button? Selective macular degeneration? Generalized cognitive degeneration? Tooth fairy in lockdown.
Bo Lox never asked me anything.
Bo asked any and every reader, particularly responders, this:
Implication beyond you? Too impersonal? Would you have liked a personalized RSVP? Something like:
Or was the aim just to make a noise over a point you didn’t want to risk a real response on?
You may be able to read minds. I, however, can only read the words. And, as I said, Bo did not ask me anything.
One possible hypothesis is that the Chinese ruling class thinks it can consolidate its already iron grip over the populace by spreading even more fear and panic, and the long-term benefits of this outweight the short-term disadvantages.
I think, THIS (COVID19) is CHINAS MOVE to REMOVE D.Trump, their huge Enemy, this is China VERY MUCH WORTH… No JOKE, try to think and resaearch. One Big Show from CHINA -> WHO -> The easiest Conspiracy EVER. WHO says, ALL WORLD BELIVE THIS absurd, TOTAL SCAM.
There may be more than a couple of thousand initially reasonable-sounding hypotheses of increasing elaboration, compared to the simplest hypothesis, that after he got to the core of his medical advice Xi Jinping was scared shitless. Those of little formal logic would count that as a QED to Occam but you might like to test things further with a preliminary consideration of the new security law in Hong Kong. Since when has the Chinese ruling elite, particularly under Gen. Sec. Xi, found it necessary to whip up any cover for increasing its grip over the populace? In the absence of any real evidence any way, are you still up for the sweat of devising a credible test? Since Mao obliterated the sparrows?
maybe they want to conduct a holocaust on the ghetto district? its not exactly a scientific argument you are making. its like arguing steve was a nice guy so jerry couldnt posibly want to spike your drink even tho they both already are convicted rapists witho sicko written all over their loser lips.
Paid troll are you? How can any of this be true if the test is fraudelent?
More testing = more cases. More cases doesn’t mean more deaths. It means the death RATE is lower. In fact, it probably means that herd immunity is on the increase. Which is good news. And is happening in the UK. Don’t read/listen to MSM !!
I don’t read the MSM except to occasionally check how much lower it sank compared to the depths they achieved last time I checked.
And your point doesn’t address my comment. Good luck with trying your non-sequiturs with other people, but not me.
More CASES = More Fear !
And FEAR = more CONTROL = more testing = DNA database enhancement = mandatory vaccines = travel certification = increased surveillance = more fear.
AND they are rolling out their needless nefarious ‘Contact Tracing’ Plan. They have already hired their “armies.” It will not age well.
herd immunity is when a planet eats lots of fruit and salad to detox a death cult spreading misinformation in terror training manuals like cnn and sky.
When is visiting day? Do you get many?
are you suggesting china is a virus infecting america with discount tshirts that harm the economy? in the oppositions version america a virus spreading dangerous music that infects the chinese people with ideas of freedom and individualism? in reality it is the unhealthy terrain that is at issue and the trading buddies should step back and focus on. fruits help to detox and regenerate tissue damaged under the acid rain.
Yes, whatever you say is true.
From the bio of a “Business Journalist”:
From the name of a “Photographer and Researcher”:
Konstantin Demeter = “Constant or Steadfast ‘Biodynamics Certification’ and/or ‘Greek Goddess of the grain harvest'”
“As above [TL], so below [TL]”, a Hermeticist and Tarot motto = “yada yada yada, yada [ATL & BTL]…”
Ahab !! The magic word !! ….”CASES”……You’re all doomed !!!
Increase in cases is meaningless without context – more cases plus less deaths means the ‘virus’ is even less dangerous
Did I say that?
A devastating critique. Many thanks for this.
“for COVID-19 we don’t have a gold standard test.”
That’s because it’s a novel virus. There likely will be a gold standard test in time.
“there are no distinctive specific symptoms for COVID-19“
Not so. That’s a patently false claim. Amongst typical coronavirus group symptoms are these specific markers of COVID-19:
– Loss of smell and taste is a very strong indicator
– low oxygen levels are a key indicator
– the autopsied lung tissue of victims is in some cases so badly damaged by thrombosis that it’s barely recognised as lung tissue under the microscope.
biophotons are needed to be able to smell and taste. uncooked ripe fruits and garden fresh salads contain biophotons.
And how is this relevant to my comment?
you also need biophotons to think clearly and not get recruited by terror networks such as the covid cult.
First, nothing that comes from an autopsy counts as a symptom of any disease. Second, loss of smell and taste and low oxygen levels are also symptoms of commom colds and other respiratory diseases. So, this argument Just confirms the original claim of the article.
Unqualified opinions are no substitute for the facts brought by highly experienced doctors, pathologists, pneumologists.
Well, I want to mention some points: first, I did not express “my” opinion; just observed that the points you brought to the table were, in fact, supporting the autors’ claims not the opposite. Second, I would like to know which are the facts you are referring to. And, finally, if we really try to be serious about the promisse of a future Golden standard for Covid19 tests, we need to recognize that only then, if so, we will be able to rely on their results, specially to support public policies, because only then they can start the claim of reliability.
“are no substitute for the facts brought by highly experienced doctors, pathologists, pneumologists“.
as seen on the BBC, Sky and all the rest of those devious, lying bastards who appear on your TV screen here in the UK .
You missed out RT in your rant.
Jose didn’t rant he successfully refuted your argument that the symptoms you mentioned were unique to COVID.
I mean come on loss of taste and smell??!! Have you ever had a cold where you didn’t lose smell and taste?
Lack of oxygen, whenever you have a lung infection the amount of oxygen in your bloodstream is the go to indicator of severity.
Your bot is stuck in a loop generating random comments. Please fix it.
With that intellectual cop-out, god forbid anyone relies upon you for medical advice.
The listed symptoms are neither unique to nor reliably presented symptoms in Covid-19 patients.
Awesome article even had a mention in the comments section of Wales Online which was taken down as are most comment there that challenge the narrative, still it was nice to know this website is being recommended here, there and everywhere which minds me of a campaign run by Clear (cannabis reform) they had a team of volunteers who they named “comment warriors” and they would go and challenge the anti cannabis articles that was basically based in codscience, they did this with factual evidence, my point is, they were organised and had in my mind a possitive effect. Here we more or less preach to the converted which is very nice, and some awesomely educated peoplel here whom I doff my cap to, but like the supermarket queues, it’s in other publications where we can make a difference, like or not we have to arouse people from their slumber, we need them to start thinking critically to have any chance of this ending, the one thing that will stop this covid19 shit dead in its tracks is the fear of revolution.
Throw away email adddresses are easily obtained can be used to sign up with, why not set up are own equivalent of the 77th brigade but unlike them , have facts and science on our side and also unlike them, we would aim to empower people not indoctinate them with scare stories and have them cower like sheep, what those working in 77th brigade dont understand, they are doing this to the very communities they grew up in, perhaps that is the attraction for them?
I think this is an excellent idea. This type of credible, science based information is required reading for those still stuck on a state of fear.
The continuation of these fraudulent testing practices and results are absolutely key for the whole charade to continue. The more people that understand how flakey the science behind the testing is, the better.
i think offline notice boards etc. may be a better option to reach new audiences in many cases.
all natural health people should realy mobilise everything theyve got quickly. like if they have a dance class use it to incorporate regenerative detox and expose the germ theory fraud.
Sadly many natural health people are completely swallowing the covid virus narrative, sad to see, this sort of info should be forming the basis of holistic treatment,
the cult would have forseen the threat and sent agents to pose as natural health people and convince them to stand down. they prepared it all over many years to have weak points reinforced but it is hopless. the best option is to come out with evidence on those ‘above’.
Start writing to your local rag if they have a letters page. Get the facts/truth out there. Keep trying. !!
I have done so on both Walesonline and the Western Telegraph, the comment keep getting deleted, there is such strict censoring there it is unreal, plenty of offensive adhom idiotic to high heaven diatribe there that goes untouched by the mods, seems they prefer ignorance over education, I note this seems to be a pattern in other local media too, I think we have to be like the black market, when one gets taken down, another immediately steps in and carries on, this would give the moderators of whereever a bit of a headache, we can all say the same thing in our own unique and indvidual ways and find a formula that works and go from there. Wales is far more draconian than the rest of the UK the fact that here in Cardigan Bay the police were the most prolific in issuing fines, 1651 was the total a few days ago, the runner up was North wales police who issued 464, I know of disabled people who were threatened with being fined by the police if they did not return home, we have seen young local families fined for being on an empty beach, the police here have never had so much power to abuse in the whole lives and look to be enjoying every minute of it.
https://www.tivysideadvertiser.co.uk/news/18546387.dyfed-powys-police-issues-1-651-lockdown-breach-fines/
I used to post there but so many idiots with insane inane and inbecilic replies that one just thinks, what’s the point, adhom attacks and a very small readership told me it was not worth the trouble.
I agree and to give an idea to those who live in echo chambers of how difficult, if not virtually impossible, it is to get the message across on a general forum to those who consider the dominant narrative to be the absolute truth, you can follow my own efforts on the following long thread on a forum for English-speaking people who live in Cyprus or have an interest in Cyprus. I moved in on this page, mainly because I noticed one sceptic was already posting there and could do with some support:
https://www.cyprus-forum.com/cyprus47300-340.html#p894926
Thanks for the link Tim, 215 pages long, one can only applaud the passion of those involved, I may sign up and see if I can add a bit of encouragement, I only want people to think critically just for one moment and look at other viewpoints instead of insisting their can only be one, on the covid19 front it is getting very sectarian.
I have just been enjoying myself on WalesOnline, currently on DragonsBreathV started as just DragonsBreath but they kept/keep deleting all my comments, now I have just been informed I have reached my daily contribution limit 🙂 so DragonsBreathVI is waiting in the wings, throw away emails and nothing else to do, or nothing else as worthwhile, I really do have fire in my belly for this fight, hence the choice of ID there.
Excellent piece. this is real honest true journalism right here
Thank you authors Engelbrecht and Demeter for proving that Covid-19 represents the weaponizing of science for nefarious purposes.
There is a “gold standard” alright for the PCR test: the oligarchs’ media proclamation that it is so. “The New York Times said, ‘Let there be Covid-19’ and behold, there was Covid-19.”
Science can salute God or play the whore to men who demand to be served as God.
Here is what I found. Comments? https://sunnybrook.ca/research/media/item.asp?i=2069
Not clear whether the virus was purified, i.e. isolated from anything that is not the virus.
I hope Off-G investigate, which I am sure they will, can only find press releases that say the same thing, no actual research papers or proof they have actually done what they are claiming, bit like me saying I just got back from Pluto (true story) and you guys simply have to accept it as I would have supplied other links that say the exact same thing. Still it gives one time to pause as it puts this awesome as article into dispute regarding the isolation part and more than sure admin will want any ambiguity to be put to rest one way or the other.
Their work needs to be replicated in other Labs. But the actual virus is irrelevant to this worldwide conspiracy: Con19 Lockdown and the wearing of the Con19 Hijab are rituals of the Con19 Religion. This year’s flu season is over, with fewer Excess Deaths than last year. That is the truth; the rest is people succumbing to an imposed belief system.
“Against stupidity the gods themselves are powerless”.
Labs around the world will isolate _several_ current Corona Virus strains because flu viruses mutate all the time (which is why vaccines are a poor defense against Flu). One of these strains, when isolated, might even prove to be the original Con19 strain: the CIA strain which escaped from Fort Dietrick and caused an outbreak of respiratory infections in Virginia, U$A. The Fort Dietrick strain may even prove to be the same as the strain which the Chinese found later in Wuhan. But to prove that, scientists would have to persuade the CIA to give a sample of the Fort Dietrick strain to Chinese scientists for comparison. All this is Grist to the Mills of Time. Let scientists only remain true to their faith in objective evidence, and superstition will eventually be dispelled.
“The truth seldom if ever convinces its opponents; it simply outlives them” — Max Planck
there is no flu vaccine. quite the opposite infact. marketing of a ‘flu’ injection distracts from real preventative/ healing actions like getting sun and improving kidney filtration with fruits and salads. dr morse has video explaining it is the medical “treatments” that then cause deaths.
any supposed benefit of the injection is simply due to differences in the sample populations. the actual trainreck of “flu deaths” are amoung those who have been injected for some years ie. the elderly rather than the single year study groups subject to the healthy user bias. that is the wakked group contains more people who go swimming and drink smoothies whereas the unwakked group has more cheese burger enthusiasts.
@Rachel: “There is no flu vaccine.” More correctly, there is _a_ flu vaccine, the one distributed every year by WHO and used worldwide, but it cannot stop the worldwide epidemic of “seasonal flu” every year. This is because the flu mutates so fast — there are thousands of new strains every year. So every spring, the WHO selects the most common flu strains from last winter, puts their names into a hat, and draws up a sweepstake to choose the most promising candidate for next winters vaccine. That vaccine is duly prepared (and sufficiently tested? We hope) before being distributed to the world public. Does it prevent the annual outbreak of seasonal flu? Not on your Nellie.
Stay healthy, Rachel. So what’s your poison? Fruits and salads, I see. Mine is nuts and beer. Our greatest ally is the jolly old flu — all those quick mutating viruses don’t want to kill us, they want us to be around for next years flu season. So they make up for extreme infectiousness and extreme mutation rate by not being very harmful — a cough and a sneeze (to spread the disease) at most, for the most of us. Gezundheit!
I am more concerned with the claims here that it hasnt been isolated, and the conflicting link provided, I will not believe something willy nilly because so and so said, there is a dissonance going on and it needs to be cleared up to make that part of the article we are discussing relevant, I appreciate and admire the sheer hard work that has been put into it, but feel this needs to be and I think it will be addressed and the article updated to reflect the corncerns, it can’t be just me who is thinking, “oh hang on a minute”
This article has been pulled apart by Andrew Kaufmann md
Absolutely fascinating that an article putting forward quite complex scientific arguments against the glib acceptance of testing methods and its results produces a welter of largely irrelevant ramblings in response.
No wonder the Covid-19 fake narrative has gained such a hold! With critiques like this, who needs the mainstream media?
Hayward, could you point out some specific “ramblings” to which you object.
“Science advances slowly, slowly / Creeping on from point to point” — Tennyson
Me too. Thumbs up/down gone.
Fine article. A lot to digest, though we knew the bare bones of it.
Maybe it’s a Thumbs Lockdown, for those who don’t comply to socially distance their sore thumbs (thread-wise).
Just refreshed and they are back! 🙂 Thumbs up to the Admins. 😉
👍 + 👌✌
This discussion reminds me of the debate that occurred over the isolation and purification of HIV.
From memory ,at least the “HIV particles ” were purified in a density gradient in ultra centrifuge tubes containing sucrose ,but there was some debate about what the Western Blots tests meant.
Or is my memory fading fast?
AIDS/HIV was and still is,perhaps less so now ,highly political -CDC changed the definition of AIDS over night resulting in more than 80,000 Americans acquiring AIDS overnight .
Definition of polio was changed to “show” how effective the vaccine was?
In the 1870’s, germ theory was pushed on humanity by the controller dickhead’s via their proxy Louis Pasteur. Prior to the forced way of thinking, humanity knew sickness came from bad air – miasma. It was fungal spores from rotting organic material that gets airborne, then breathed in. At that time the antibodies attack the spore and then the spore releases the germs to fight the antibodies. By having humanity look for sickness via germs, they have us with our heads up our collective ass, on purpose. Where I reside in Wisconsin, the paper companies have been making it smell unGodly for weeks and weeks. The huge meat processing plants have smelled God awful for weeks and months and where are the outbreaks? That’s right, in the meat processing areas, why? Rotting organic material. The paper mills here were all hydro-electric damns as far back as the 1600’s and once the controllers took over america in the 1812 reset, all electricity was stopped, at least for the people.
Also, once the controller dickheads pushed germ theory on the world (and you dumb fucks think it’s the shit), they then were able to say that those not practicing germ theory are bad and must be closed down, hence the creation of the mafia, errr, American Medical Association. They arrested and chased out doctors who were actually healing people, like the doctor who had to escape to mexico and he invented a chemical microscope in 1932 that wasn’t bested until 1997. Now the contollers and their minions go to that very same Mexican clinic that doctor started once he was chased out of America.
Now, consider that fake wildfires that killed perhaps a billion or two animals between Australia, Cali, Russia, New Zealand and South America. That was to create ‘coronavirus’, miasma – bad air. Now in Texas, they had ranchers kill thousands of livestock in March/April and were forced to leave the carcasses rot where they dropped, creating what do you think? And now a big outbreak in Tx, no shit…
Some guy was sued by the german govt a few years ago because he said measles are not a virus, they are a reaction to EMF radiation toxicity built up over years. He proved it in a a world court, yet we still treat measles like a virus when it is NOT.
Science should be spelled psyience because it’s nothing more than a control system for your mind. It is controller conscripted bullshit, like their religion. Church’s were not places of worship, they were the 5g facilities of their day. Your history is a lie, America took over another civilization that built the cities. You try and convince me that 2000 people built all of San Francisco in 4 years, I say go f yourself
“Science should be spelled psyience because it’s nothing more than a control system for your mind.”
Yawn.
… now … returning from Planet Zog …..
You are probably talking about Stefan Lanka, but he was not sued by the German government. What happened was that he offered €100,000 to anyone who could prove that measles was caused by a virus. A doctor put forward 6 published papers that he claimed proved it. Lanka thought he could prove that they didn’t, but a German court decreed otherwise and the doctor was awarded the prize. However, Lanka appealed and the appeal court ruled in his favour, but supposedly only on a technicality which supporters of the measles virus theory claim did not prove his case.
The story is here in full in German:
https://wissenschafftplus.de/uploads/article/goVIRUSgogogo.pdf
This article (in English) is his overall case against viruses being the cause of diseases, with Measles as an example. He touches on the court case briefly:
https://wissenschafftplus.de/uploads/article/Dismantling-the-Virus-Theory.pdf
Are you talking about the Tatars in regards to San Francisco?
Saw some really interesting info awhile back showing really large and very well built buildings in San Francisco around the time of the 1906 earthquake, but I lost the link.
stolenhistory.com
@PS. I think you chose a good name for your post: Scum. The germ theory is an established fact, you can see pictures of germs in the pages of books and other media. The last anti-germ die-hard left over from the Phoenician Age was George Bernard Shaw; and even Shaw abandoned his superstitious campaign against modern medical science when it came to saving his own life.
I note that the above post, from Phoenician Scum, is one of those “irrelevant ramblings” which cause Hayward not only to comment here but also to emit an anguished cry of general despair later on in this thread.
no one is denying “the germs” aren’t there, it is the same old correlation/causation argument. what role are they playing, can they be shown to the cause of disease or are they just phenomenon of the disease? This question is at the centre of the allopathic/ holistic debate.
Chris, you are denying “the germs aren’t there” (sic) when you apostrophise them (“the germs”) and argue whether they cause disease “post hoc ergo propter hoc”. That argument was settled nearly two centuries ago by Louis Pasteur b.1822; and the last anti-germ crank of any significance was Bernard Shaw b.1856 with his feeble argument, “Show me the germ of overwork”.
All of which, as Hayward complains, is irrelevant to the point of this thread which is: the Con19 test is a con. And the man who complains most about present misuse of his method is the man who invented it; a truly excellent method, but by no means can it be used as a test for flu — unless you intend to con the public into believing false positive evidence for the nonexistent Pandemic which I name Con19 (it ought to have a date name like Con20 or Con2020, because it comes from the same stable as Con911)..
I put “germs” in apostrophes to show that the term is rather vague not to deny the existence of bacteria/ viruses/ protozoa or other supposed agents of disease They have been found, but their role within disease are I believe not fully understood. Pasteur did not irrefutably proof anything and some say he made up his findings, there are many “cranks” that still doubt the germ theory of disease, not because they do not exist but because some see them of a symptom of ill health not necessarily the cause. If this is right then the Covid con, as you so rightly call it, is part of a wider con/misunderstanding that we would do well to understand, ,aking it a pertinent point to this thread. Even if I am wrong falsifiability is the basis of science so it is good to keep questioning those narratives we deem incontrovertible, science should not be a doctrine of dogmas but a constant questioning of our closely held beliefs. I deem that Bechamp disproved Pasteur and this debate goes on, evidenced by some virologists maintaining that viruses are the same as exosomes.
claiming a photo of something is evidence it is a cause rather than consequence sounds like extreme pseudoscience. where did you learn such abstract thought vomit?
Photos of germs are commonsense evidence of their reality in the 21st century. Post hoc ergo propter hoc: that early Victorian train has not run since 1850.
Louis Pasteur, Robert Koch and the Germ Theory (still known in some quarters as, A Thought-vomit of Pseudoscience):
https://www.timelineindex.com/content/view/2737
Thanks for your sensible, considered, respectful contribution to the debate.
Suddenly this morning the thumbs up and down feature disappeared at “my” version of the threads… Still shows “reply” though.
Is that a permanentized feature, a momentary glitch, or just me?
John
Same for me so it may well be a change of approach to comments. I can see definite benefits. OK it’s nice to know that people actually read our comments and also support them, but if someone chooses to disagree with a comment it virtually obliges them to explain their position rather than just down voting with no opportunity for any reply from the original poster or those who agree with him/her. Equally, could lead to more ad homs! 😀 As you say, it may, of course, just be temporary.
I hope it’s temporary. Readers can’t be expected to respond to so many comments. I’ve seen this happen on other boards and it allows deep state trolls to take over the comments section.
After I recently refreshed the page, the feature had returned.
Someone put into weighty, credible words what I have always suspected: Bill Gates is doing what he is told.
“It is so extraordinary that you and I live on a planet with these other well educated, intelligent people and yet we have no idea what is the governance structure on our planet.” – Catherine Austin Fitts
OCCULT governance structure.
Secret is not by chance. It’s by long long design.
I had one say to me last year, “I come from people who try to “hide the Cracker.”
I asked him if that meant the Eucharist, and he nodded and affirmed that suggestion. While also not copping that he was party.
We went back and forth, then I mused, “God reveals a Mystery to help us better understand God’s nature. Those who obscure a Mystery do so because they want to possess It.”
He turned away, took a deep breath, then concurred, “Well said!”
I knew for 20 years that he and his wife are local influential directors of a prominent institution affiliated with the Catholic Church, but it was only now that he had told me he was a 3rd° Freemason, when I had told him my father had been attorney to several 33rd° Freemasons. I was never party to any of that, carefully excluded it seems, though there is no use denying the bloodlines, I suppose. As with my two middle names, I was too young to protest.
This 3rd° was with a young associate who was also one, and I stammered, “But, but I have read it’s been long under the Ban by the Church.”
They assured me that that was not the case.
I changed that thread of the chat, and waited to research later.
Turns out 11 Popes have issued proclamations prohibiting dual membership.
But that does not seem to have stopped a number of Mexican Présidentes of the last century from being dual “membership”, including Plutarco Calles who in 1925 made any evidence of Catholic religiosity a capital offense, and blithely shot many priests summarily (a really really good dramatisation of this is the recent movie Christiada, or in its English-language original, “For Grester Glory” with Andy Garcia, who does a great tour in spite of his Miamian Cubano expatriate anti-Castro zealotry, that whole rabid So. Florida crowd). Calles got 100,000 people killed in a couple years, dragging Catholic fathers out of their beds in the wee hours to have wives and children watch while they were executed on site. Much as the Gestapo was doing a few years later in Germany, or Batista did gleefully in Cuba 10- 20 years after those.
For his enthusiasms Calles was given a special award by the Mexican Scottish Rite lodges for his “work against the Catholic Church in Mexico.”
Translation from their Spanish courtesies: to DESTROY Her.
Same with the Vatican Banking Scandal 40 years ago, all the head CFO types were Freemasons, and Berlusconi wss discovered to be a “dues-paying member” in that “pseudo” lodge, P2 (aka Propaganda Due).
And of course it doesn’t take much spandex content in the fibre of thought to connect these dots with the sustained pogrom by MSM in the pedophilia scandals, which have been known –JUST as they have known the real facts about their pet “virus”– to match the percentile of such heinous transgressions in every institution, as a constant.
Yet again: like US prison populations as 25% of the global numbers, as our Covid breathless ubiquitous death tallies are 25% of the global count ,(we count 10 times as many as India, despite having only, yes, 25% their population, and our mostly hard lockdown compared to their case, where lockdown is not a luxury that is even feasible.
Hmmmm. Many many like patterns seem to emerge…………
My two cents are on the solid bet that exalted international Freemasonry, with Nazi allies et al., is behind all of this (not much of the rank and file, who are too busy with good deeds as a tried and true “Human Shield”).
Hard to disprove. A lot easier to prove.
At least with such centuries of preponderant evidence, especially the recent solid cases I include, such as Roberto Calvi, P2 Italian Lodge, and CFO of Banco Vaticano, who was hanged in that scandal in progress in 1982 on Blackfriars Bridge on the Thames in London, as a staged suicide.
Same year my old man, 33rd° Armand Hammer’s lawyer, was suicided, though I didn’t need to even break a sweat to prove that murder, since I found out in 2000 that LAPD had always had it filed in their very own XFiles as a “cold case”.
It’s some comfort to finally find these bogus suicides are really murders…. (Cf. RW 8.12.14)
Just as it is to find out that so many diseases –or the attendant corollary “financial instruments”–are (also stone cold) heartless skkkams. Right?
Not soon enough, but quite soon enough for their souls, “their” Judgment is coming…. Jus’ sayin’
May God have Mercy on their souls, but not their purgatorial “wallets”!
£4£&$4$&€4€+my2¢~~~~~~~~~~~~~~~
Correction: in haste I mistakenly suggested Calles of Mexico was “dual membership” and Catholic, but he was a hardcore atheist, raised as an orphan by a vitriolically anti-clerical uncle. Yet it is interesting, after years of murdering mayhem, towards his death he was becoming theistic, apparently. But Freemason in his murdering years. That’s clear. St. Miguel Pro, S. J. could write that in his own blood. And 15 years old Cristero St. José Sanchez del Rio.
As my piano prof and the Holocaust survivor Arnold Juda, head of UCI Piano Dept. said once when I used the word “Nazis”,
“Our Friends.”
They had dealt with his youngest brother on like terms.
Great comment. Just wanted to log that at least one OG reader (and from Freemasonry grand central aka “Great” Britain) totally comprehends all your references and their relevance to current events!
More (possibly) on rebellion surfacing in official spaces:
Journalist John Ziegler speaking to the Ventura County Board of Supervisors. Dr. Levin is Ventura County’s medical director. (2:36 mins; a blistering tirade)
Drops mic…
How meaningless the tests for this thing are is an important question.But, more important, is the question of what the actual virus is.If it’s real. And, if it is real, does it seem like a natural virus or a ‘Frankenvirus’. As we are continually being lied to by those who choose to carry out these disturbing psyops,we can only discuss circumstantial evidence, so to speak.They’ll be labelled conspiracy theories for sure.But not by anyone who has an opinion that matters.Besides, now that we know for sure that governments have paid hard cash to hospitals to lie about patients deaths and diagnoses and paid the media to screen sci-fi horror movies to frighten the public into compliance and subservience, it;s us who can accuse others of conspiring to deceive. And we have the luxury of knowing it’s not merely a theory now.All we need to know now is what their motive was.
It has long been suspected by those who don’t eat any old BS blindly any more, that those in power were playing the long game.The object being to gain total, global control over a population too scared to argue or too chemically coshed to perceive the need to.We can call them the NWO, the illuminati, the elite. What’s in a name.So many do so much behind closed doors in little cults it ceased to matter a long time ago.It’s quicker and more accurate to just call them ‘the cult’.They fly the skull and crossbones with pride.So many democracies boasting of their liberty and our good fortune as they gather round their little cauldrons in dark churches in secret places.
The game is drawing to a climax now.Chemically poisoned food and water and Trojan Horse viruses in seemingly harmless vaccines and technology providing new ways to interfere with our natural vibrations and disturb our equilibrium.And, of course, the age old favourite, bio warfare.take 3 or 4 nasty, lethal viruses, add 3 or 4 even nastier nihilists who revile humanity, give them a lab, stir, and wait.Welcome to 2020.
There are an estimated 100 million viruses on our planet.And that’s only on land.You’d think that would be enough to cope with without some lunatic trying to make a few hybrids.The motivation has to be evil.Viruses are clever little things, hence their longevity.But they’re not the most interesting of characters.They live to spread illness and death.Our immune systems have evolved to do battle with these tiny terrorists.Nature has decreed we make fine battlefields.It’s only when an unnatural virus occurs that our immune systems get confused.These unnatural viruses occur by a lunatic taking it upon himself to create a virus dating site.he puts two or more together and let’s them get jiggy.The offspring will likely be a maniac.So, the proud dating agent will have a potential money maker if he can isolate the blighter and create a vaccine to defeat it later on.Or at least one that people would pay for if it could immunise us against it.Once that’s done, it’s just a matter of accidentally letting it ‘escape’ and wreak havoc.Let it attack a group that can be studied against other groups.Maybe black people; or gay people.Then let that spread.Soon enough the casualties will be in the millions and the fear will be spiking.Enter the rescuers.Throw a contract or two at some big pharma companies that the rescuer has patents and shares in and pop a Nobel prize his way, everyone’s happy.Just another billionaire satanist.
So what of this current mystery virus.Who are the suspects.What was their motive.Why are they exempt from legal proceedings.
Our DNA code is literally made of viral sequences.In addition, most viral sequences are integrated in our non-coding genes.’‘ Coding genes are like musicians who, instead of producing sound, produce proteins, which are the fundamental building-blocks of all life forms.”In 1996, Roy J Britten, of the California Institute of Technology, was able to list ten examples in which endogenous retroviral sequences helped regulate the expression of a useful gene. Seven of the ten examples were human( Frank Ryan – Virolution).
Man made viruses have been commonplace since the 1970s.The active ingredient in most modern vaccines is a genetic sequence extracted from a virus (the sequence that is considered immunogenic but not pathogenic). A paper from 2001 describes how genetically-modified viruses can be used to develop vaccines.S– how can we develop one for a virus nobody has found and isolated yet ?
A more disturbing development in the area is learning that natural viruses can alter the behaviour of the host.A man made virus can too.It takes little imagination to realise the implications of this in the type of hands that lust for control over the world’s population.But that’s another area for another day…
So -man made virus accompanied by man made hysteria ? Or real virus accompanied by man made hysteria ?
Luc Montagnier is a retired French scientist. He received the 2008 Nobel Prize in medicine for his discovery of the HIV virus.Montagnier described SARS-CoV-2 as :
”a man-made “Frankenstein virus” .According to Montagnier, the Franken-virus was made from a natural coronavirus, coming from a bat, but to this model was added sequences very similar to HIV-1 and the parasite Plasmodium falciparum, which is responsible for malaria”.
This point might explain why hydroxychloroquin – an anti-malaria drug – is effective against SARS-CoV-2.Why, exactly,certain pharmacists were ordered by the government to refuse to honour prescriptions for HCQ I’ll leave for you to ponder.
To the question: “Wasn’t the coronavirus natural?” Montagnier replied: “No, it was not natural, it was the work of professionals, of molecular biologists, it’s a very precise work, we could call it a watchmaker’s work”.
Judy Mikovits was a lab director at the U.S. National Cancer Institute, and was part of the team that was first to isolate the murine retrovirus XMRV. She also worked for several years at Fort Detrick, the U.S. Army’s most infamous bioweapons research lab.Mikovits is one of the few who has dared to denounce the vaccine scandal, for which she subsequently lost her career, her savings and her reputation. She publicly stated that, given the astounding number (1,200) of mutations between the new SARS-CoV-2 and the source bat virus, the former had to be engineered:
”That cannot be naturally occurring. Somebody didn’t go to a market, get a bat, the virus didn’t jump directly to humans. That’s not how it works. That’s accelerated viral evolution. If it was a natural occurrence, it would take up to 800 years to occur.”
Bruno Coutard is a researcher for IHU Méditerranée Infection, one the largest virus research facilities in the world. On April 2020, Coutard et al. published in Antiviral Research a detailed analysis of SARS-CoV-2
“In 2019, a new coronavirus (2019-nCoV) infecting humans has emerged in Wuhan, China. Its genome has been sequenced and the genomic information promptly released. Despite a high similarity with the genome sequence of SARS-CoV and SARS-like CoVs, we identified a peculiar furin-like cleavage site in the spike protein of 2019-nCoV, lacking in the other SARS-like CoVs […] This furin-like cleavage site… may provide a gain-of-function to the 2019-nCoV for efficient spreading in the human population.”
Now we’re getting to the core…
In true Orwellian ‘double think / doublespeak’ fashion we have the sweetened pill of ”gain-of-function’. A beautifully disguised expression meaning ‘ man made’. According to Coutard, it is this man-made intervention that enabled a zoonotic (bat) virus to ‘jump’ to humans.
Czech molecular biologist Dr. Soňa Peková explained that SARS-CoV-2 was man-made because of its deeply modified “control room”:
”massive gene changes and transcripts, insertions, deletions, and other complex changes in the magnitude of the RNA SARS-CoV-2 control room, if nature had created it chaotically and randomly, the virus would simply perish because it could not have functioned in an orderly manner.”
It seems almost unanimous outside of America.Far from Fort Detrick.
It’s a sinister development to allow mad scientists to play God one day, Satan the next and then Frankenstein in their spare time.But it generates two things beloved to those in power who meet in those little covens ; big money and genocide.In between the injured have the kind of damage that puts them out of the game anyway.
We’re all familiar with Bill Gates. The man credited with putting Microsoft and it’s Windows together and being named richest man on his planet more than once.He is also known for an obsessive preoccupation with trying to lower the world’s population.His main means being vaccination.His other lust is for having those he spares chipped in order that they can be tracked to any hiding place they may try and use, and to be an open book to those above who want to read your life from day to day.He hasn’t studied medicine. He’s studied eugenics and social engineering.He and his elite brothers see this life as a pest control problem.His sponsored media whores promote his ‘philanthropy’ so we buy him.His dear friend and fellow nihilist billionaire is Tony Fauci of the NIAID.He’s the little guy who kept popping up like Trump’s conscience during early daily briefings about the pandemic.He was also the first to panic and issue warnings that Trump’s recommendation of using HCQ to beat the virus was dangerous.Even though other countries have found that it cures it.So why panic ? Maybe we’ve found our prime suspect.
Fauci is another man with an obscene amount of billions in his back pocket. Most of which were ‘earned’ by patenting ‘cures’ to the recent celebrity viruses that made all the front pages.Could it be that he has an agenda ?More big money to be made from his patents ? he and Bill have been the media puppets warning us of all the horrors that are over our heads and how dangerous it is to ignore them.They say ‘normal’ won’t return until we all have a vaccine they have yet to make because they aren’t isolating the virus( or so it appears..maybe they’ll isolate it once they agree on some more numbers and give us another ‘rescue package’ promise).
We have all seen the now infamous announcement made by Fauci.It was the opening of 2017.A new year and America had a new President.Cheery Fauci told us: ”there is “no doubt” Donald J. Trump will be confronted with a surprise infectious disease outbreak during his presidency.’‘. That isn’t very scientific is it.He was supposed to use words like ‘likely’ or ‘possibly” and explain why this little monster was likely or possible. But he said it like a promise.Or a threat.And, by the close of that year we may well have found the source of his absolute confidence in his own promise.Because at the close of that year in December,the NIH ended it’s ban on ‘gain of function’ research.It agreed to fund it again.And so the Frankenstein team could get busy.They can blame China later.
So, the exercise – or drill- was manufactured over a couple of years and just before the end of trump’s first term- guess who arrives. Mister Covid.
There’s more I could say but it annoys me to think about this crap too long.
I’m indebted to Pierre Lescaudron for some of the above science.
https://www.businessinsider.com/nih-lifts-ban-on-flu-mers-sars-virus-gain-of-function-research-2017-12?IR=T
https://www.healio.com/news/infectious-disease/20170111/fauci-no-doubt-trump-will-face-surprise-infectious-disease-outbreak
just because they published a sequence isnt evidence anyone else has that sequence or that it caused anything. those labs have many sequences they could write about.
But it would indicate ‘ gain – in – function’. In the context of the whole Covid 19 ‘enigma’, the implications of that outreach the implications of the virus alone. It suggests a concerted effort by scientists to create it.By extension, that would suggest that they wanted to create it. So- why ? And, considering nobody- we’re told- has isolated it, we seem to be on the receiving end of a limitless list of damage it can do, how it behaves, and how we might combat it.Yet nobody has caught it and kept it still yet.It smacks of bio weaponry.
also just as a bit of fun really – is it fun though? someone is having a laugh
look at this
Possibly the most linguistically weaponized news story i have read since the Ricin scare in the UK back in 2005
absolutely ludicrous
zombies…tentacles…
“Researchers exploring the interaction between the coronavirus and its hosts have discovered that when the SARS-CoV-2 virus infects a human cell, it sets off a ghoulish transformation. Obeying instructions from the virus, the newly infected cell sprouts multi-pronged tentacles studded with viral particles.
These disfigured zombie cells appear to be using those streaming filaments, or filopodia, to reach still-healthy neighboring cells. The protuberances appear to bore into the cells’ bodies and inject their viral venom directly into those cells’ genetic command centers — thus creating another zombie.”
AND THERE’S MORE – ALIENS [FEAR-A-GANDA]
“Like space invaders in a science fiction tale, the tiny virus was known to dock on the surface of the much larger cell. A viral landing party came aboard and hijacked the cell’s usual function, making it a factory for its replication.”
https://www.yahoo.com/news/inside-body-coronavirus-even-more-150022628.html
Sounds like a bad TV Star Trek episode, like weaponising “the Trouble with Tribbles” into an über-camp ’50s b&w sci-fi horror flick, the Beast with Five Fingers and some Peter Lorre voice overs.
Really delicious, I’m still convulsing.
Thanks for ferreting that one out of the MSM Cesspool.
Oh yes, Tribbles. Those seemingly benign, simple, furry little critters who were anything but. Now why do they make me think of Boris Johnson? 😀
https://www.amazon.co.uk/Star-Trek-JAN131635-Tribble-Beige/dp/B00APPEGXM
😅😅😅😅🤔
Definitely a ROFLMAO from me!
if you didnt water a potted plant and then when it started wilting labelled the cell tranformations a virus it might appear to take over cells quite rapidly. in reality tho the plant was dehydrated same like hydrating fruits are beneficial to humans in an acidic state.
spot on, I think
this is the best i’ve read on this subject in a while – thank you – please update on further replies to your enquiries – this is very shady indeed…remember this? unrelated?
“There have been many suggestions: stealth viruses that could be introduced covertly into the genomes of a given population, and then triggered later by a signal, ‘designer diseases’, and bio-warfare agents in agriculture such as the Fusarium used against drug plantations in Colombia and elsewhere.”
http://www.declarepeace.org.uk/captain/murder_inc/site/texts/gm.html
The tipping point. There comes a time when a story is so big, it requires a bigger one to cloak it.
Bill Gates, Jeffrey Epstein and Ghislaine Maxwell.
Charlie Robinson, author of The Octopus of Global Control (2017) speaks to Shaun Attwood.
https://wirralinittogether.blog/2019/10/07/epstein-clinton-maxwell-interview-shaun-attwood-talks-to-charlie-robinson/
https://wirralinittogether.blog/2019/10/21/shaun-attwoods-second-interview-with-charlie-robinson-fascinating-new-information-on-epstein/
i noticed that transhumanit Aubrey de Grey is involved too — Epstein gave Gates a tip to invest in a transhumanist MIT scholars research {?} company [?] – linking this back to Aaron Scwartz and his MIT pedo data dump find is not unrewarding. the real question is – genetics – young people – Epsteins fascination with a super race…from his own seed. possibly a plan for race of non aging super strained proto-humans…on the way to the transhuman agenda, no doubt funded by the very few who have invested interest in staying in control – IE Rockefellar [how many heart transplants now?] theyare fighting to be immortal – and i’ve a feeling the whole 2020 saga is a WWF style Opposite to BUMFIGHTS – elite fights – the younger generation of wannabe god complex freaks are out to kill their masters [night of the long knives style ] and take control of Planet earth cartel [tm] Politrix is fun
Epstein and friends, who included Bill Gates, were likely compromised on an elevated level – but coverups and blackmail are standard practice in day-to-day politics.
There are lots of people with skeletons in the closet in all fields of society because the intel agencies do not generally like anyone in power whom they have no means of controlling. Flawed people get promoted.
Mark Sedwill, the UK’s Head of the Civil Service and National Security Adviser, is in power partly because he went along with a decision to destroy public records on pedophile politicians. That blocked any effective public inquiry, even though Theresa May’s government had promised one. However the intel services certainly have their own copies.
Top British civil servant unable to explain missing child abuse files – Reuters, 2014
https://www.reuters.com/article/uk-britain-abuse/top-british-civil-servant-unable-to-explain-missing-child-abuse-files-idUKKBN0FD0WL20140708
The cat wriggled out of the bag in a 1995 BBC interview with Tim Fortescue MP, head of ‘party discipline’ for the Conservatives, known in Britain, appropriately enough, as the Chief Whip.
Fortescue said that politicians would come to their party managers and disclose problems with debt or “a scandal involving small boys”….
The party would keep the matter quiet because it provided “brownie points” or material that could be used to blackmail or put pressure on politicians when needed.
Note that Epstein’s photo collection was seized, in part or whole, by the FBI but there hasn’t been any word on what’s happened to it since then.
Interestingly, a month or two ago, BBC Radio 4 was running the latest series of a drama based on a book by G.F.Newman (who wrote an explosive highly realistic TV drama about corruption in the police, the legal profession and the prison service in the 1970s), called “The Corrupted”.
The action of the drama (6 series completed) runs over many decades, the most recent being the 1990s. This series featured a head of the security services being a pedophile, and forcing other pedophiles whom he’d become aware of to do work for him in return for protection against prosecution.
As well as the police, the legal profession and the prison service being shown to be corrupt, we are also shown a corrupt security service (as above), and corrupt politicians (of course).
In fact, just about the only organisation that isn’t shown as being corrupt is, er, the BBC… 🙂
Attwood shouldnt be linked to on here because the truth is sacred.He is a tool on a hill.
And he interviews hard men.
Sean Atwood means well i have no doubt.But you need more than that. I’ve watched a lot of his videos.They’re divided between interviewing ex convicts and plastic gangsters talking about nothing and the rest of the interest is focusing on what’s trending.He puts all the right buzzwords on his video tag; Use the words ‘bombshell’ and ‘shock’ along with ‘breaking’ then add the controversial names like Epstein, Maxwell, Gates, Clinton/s, the McCanns. Then we get his guests who worked’ on the inside’ or had close relationships with all of the above or-sometimes- even Mossad. What we get is a guest who can speak at 100 words per minute telling us nothing we haven’t been reading for years before Sean discovered youtube as a little money maker.A lot of it is even in the mainstream.These guests are normally selling a book too.They see Sean’s views and subs and decide there’s a good place to pitch.Everyone’s tugging sleeves for small change. The end result is a lot of innuendo and references to ‘sources’ that have no name.
We all know about the Jewish mafia, Israel, Mossad and Epstein’s contacts to all of the above as well as political giants too.We know he had a privileged existence because of this. Everyone had their own version of a black book on everyone else.Leverage is control.They don’t spend billions in dark corridors to keep secrets only for them to easily leak on to the youtube accounts of up and coming wannabe alt researchers trying to sell something most people already had anyway.Where are the victims of abuse – do they have names ? Do their abusers ? And why aren’t they seeking justice themselves ?We can all guess.We can all opine.But there’s a few out there who think that the stronger your belief becomes in something the more it becomes a fact.Look again- it’s all just vague.Sean can call it ‘deep digging’ and call things a ‘rabbit hole’ or some other snappy catchphrase.But it isn’t that. It’s only gossip.